We narrowed to 71,484 results for: nin
-
Plasmid#250772PurposeMammalian cell expression of the delta opioid receptor with the last 17 amino acids of GLUT4, in which both leucines in the "LEYL" sequence are mutated to alanineDepositorInsertDOR-GLUT4(AEYA)
TagsAPEX2 and Signal Sequence FLAGExpressionMammalianMutationdelta opioid receptor with last 17 amino acids of…PromoterUBCAvailable SinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
puDNA5_SSF_DOR_GLUT4_LEYA_APEX2
Plasmid#250771PurposeMammalian cell expression of the delta opioid receptor with the last 17 amino acids of GLUT4, in which the second leucine in the "LEYL" sequence is mutated to alanineDepositorInsertDOR-GLUT4(LEYA)
TagsAPEX2 and Signal Sequence FLAGExpressionMammalianMutationdelta opioid receptor with last 17 amino acids of…PromoterUBCAvailable SinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
puDNA5_SSF_DOR_GLUT4_LEAL_APEX2
Plasmid#250770PurposeMammalian cell expression of the delta opioid receptor with the last 17 amino acids of GLUT4, in which the first leucine in the "LEYL" sequence is mutated to alanineDepositorInsertDOR-GLUT4(LEAL)
TagsAPEX2 and Signal Sequence FLAGExpressionMammalianMutationdelta opioid receptor with last 17 amino acids of…PromoterUBCAvailable SinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
puDNA5_SSF_DOR_GLUT4_AEYL_APEX2
Plasmid#250769PurposeMammalian cell expression of the delta opioid receptor with the last 17 amino acids of GLUT4, in which the first leucine in the "LEYL" sequence is mutated to alanineDepositorInsertDOR-GLUT4(AEYL)
TagsAPEX2 and Signal Sequence FLAGExpressionMammalianMutationdelta opioid receptor with last 17 amino acids of…PromoterUBCAvailable SinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
puDNA5_SSF_DOR_MRS_2Ala_APEX2
Plasmid#250763PurposeMammalian cell expression of the delta opioid receptor with the last 17 amino acids of the mu opioid receptor, in which the leucines in the LENL sequence have been mutated to alaninesDepositorInsertDOR-MRS(2Ala)
TagsAPEX2 and Signal Sequence FLAGExpressionMammalianMutationdelta opioid receptor with last 17 amino acids of…PromoterUBCAvailable SinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pUC19_CoV-2_frD1_XBB.1.5 S
Plasmid#253119PurposeFor recombinant virus rescue; encodes fragment D1 of SARS-CoV-2 (nt20950-25522), Omicron isolate XBB.1.5 SpikeDepositorInsertSARS-CoV-2 Omicron XBB.1.5 spike
ExpressionBacterialMutationS: F1089FAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pNarsenic_noProm
Plasmid#247321PurposeControl plasmid for pNarsenic lacking the ArsR-regulated promoter upstream of the reporter geneDepositorInsertsfdeR
mkate2
Arsenical resistance operon repressor
UseSynthetic BiologyPromoterNone, P_fdeA, and P_fdeRAvailable SinceMarch 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pANC98c(3xFLAG-NES-FRB-(G4S)4-cTEV(219)-IRES-EBFP)
Plasmid#248359PurposeLentiviral vector that can express FRB along with a truncated C terminal split TEV. Expressed off of CMV tet ON promoter with EBFP markerDepositorInsert3xFLAG-NES-FRB-(G4S)4x-cTEV(219)
UseLentiviralPromotertight TREAvailable SinceJan. 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
UbSYHRE_pDONR201
Plasmid#249817PurposeEncodes UbSYHRE (UBQ-HRE1-GAL4STE12), Gateway compatible as Donor plasmidDepositorAvailable SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-FH-hnRNPC
Plasmid#245722PurposeExpress Flag-HA-hnRNPC in mammalian cellsDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTB105
Plasmid#236778PurposeBackbone for cloning sgRNAs to be used with CRISPR Cas9 cytosine base editor. Expressed from the 18S rRNA SSU locus in Leishmania. Contains puromycin selection marker.DepositorTypeEmpty backboneUseCRISPRAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
EBFP2-K1K2
Plasmid#242819PurposeEncodes human kindlin1 containing kindlin2 F3 domain and N-terminal EBFP2 tagDepositorInsertKindlin1 (Fermt1 Human)
ExpressionMammalianMutationKindlin1 chimera containing the F3 domain of kind…Available SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-DEST (JDW 471)
Plasmid#242573PurposeGateway destination vector with a CAGGS promoter in the backbone.DepositorTypeEmpty backboneUseGateway subcloningAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
EBFP2-K2K1
Plasmid#242820PurposeEncodes human kindlin2 containing kindlin1 F3 domain and N-terminal EBFP2 tagDepositorInsertKindlin2 (FERMT2 Human)
ExpressionMammalianMutationKindlin2 chimera containing the F3 domain of kind…Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Integrin β6β1-EGFP
Plasmid#242829PurposeEncodes human integrin β6 chimera containing integrin β1 cytoplasmic domain and C-terminal EGFP tagDepositorInsertIntegrin subunit beta 6, transcript variant 1 (ITGB6 Human)
ExpressionMammalianMutationIntegrin β6 chimera containing the cytoplasmic ta…Available SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-SV40
Plasmid#226453PurposeFor subcloning of SV40 promoter or for assays using M13 phageDepositorInsertSV40
UseCloning vectorMutationNoAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYihI-N+C-term K-R
Plasmid#233093PurposeExpression of GST-YihI with N+C-term lysines (K) mutated to arginine (R)DepositorInsertGST-YihI with N+C-term lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationGST-YihI with N+C-term lysines (K) mutated to arg…Available SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-N-term K-R
Plasmid#233091PurposeExpression of GST-YihI with N-term lysines (K) mutated to arginine (R)DepositorInsertYihI with N-term lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationN-terminal lysine residues mutated to arginineAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits