We narrowed to 60,950 results for: Ran
-
Plasmid#100025PurposeMammalian expression of fluorescent reporter for calcium signaling, based off of GCaMP6s. Contains a stable reference Large Stokes Shift (LSS) mOrange nested within the reporting cpEGFP.DepositorInsertMatryoshCaMP6s
TagsV5 Epitope TagExpressionMammalianPromoterCMVAvailable SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCSIIbsr-Eevee-ROCK-NES
Plasmid#209918PurposeA FRET biosensor for ROCK activityDepositorInsertEevee-ROCK-NES
UseLentiviralTagsECFP and YPetAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYES260-sc.eEF2 K509A
Plasmid#85120Purposeyeast expression of mutant EEF2DepositorTags6xHisExpressionYeastMutationK509APromoterGAL1Available SinceNov. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRK5-HA-C12orf66
Plasmid#87048Purposemammalian expression of C12orf66DepositorAvailable SinceMarch 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-gst-xr
Plasmid#214761PurposeXylose reductase from Hypocrea jecorina fused with GST-tagged and codon optimized for expression in E. coliDepositorInsertglutathione S-transferases fused with xylose reductase
TagsGlutathione S-transferasesExpressionBacterialPromoterT7Available SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAC2-dual-dCas9VP48-sgExpression
Plasmid#48236PurposeDual expression construct expressing both dCas9VP48 and sgRNA from separate promotersDepositorInsertdCas9VP48
UseCRISPRTagsHA-tag and VP48ExpressionMammalianMutationD10A H840A (catalytically inactive)Available SinceSept. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-DU422gp140-TM
Plasmid#123251PurposeMammalian expression plasmid for soluble gp140 from the DU422 HIV-1 isolate with a transmembrane tetherDepositorInsertHIV-1 (DU422) Env
TagsCD5 leader peptide and Linker (with 6his tag) and…ExpressionMammalianMutationCodon-optimized synthetic genePromoterCMVAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMax_BFP_A191G
Plasmid#177823PurposeSite-specific mutagenesis of tagBFP for the purposes of creating a site-specific U:A mispair for the purposes of measuring UDG activity via Host Cell Reactivation (HCR).DepositorInserttagBFP_A191G
ExpressionMammalianMutationA191GPromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV Renilla Luciferase L5-L2
Plasmid#62186PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and renilla luciferase module. Compatible with MultiSite Gateway cloningDepositorInsertRenilla luciferase
UseLuciferase; Mule gateway entry vectorExpressionMammalianPromoterCMVAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pENTR_sfGFP-TurboID
Plasmid#240226PurposeGateway entry clone with TurboID tagged with superfolder GFP (contains stop codon)DepositorInsertsfGFP-TurboID
UseGateway shuttle vectorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3015b
Plasmid#209317PurposeExpresses a sgRNA template with a protospacer cloning site flanked by BsaI restriction sites for easy insertion of a targeting cassette.DepositorInsertGroup B Streptococcus-compatible single guide RNA
ExpressionBacterialPromoterXyl/tet promoter that is constitutively activeAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
cjBlue chromoprotein
Plasmid#117844PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses cjBlue chromoprotein in E. coliDepositorInsertpromoter, RBS, cjBlue
UseSynthetic Biology; Escherichia coliMutationBioBrick sites removedAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHis6-hDF
Plasmid#72585Purposehuman dysferlin full length tagged with HisDepositorAvailable SinceApril 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMuLE Lenti Dest Neo
Plasmid#62178PurposeMuLE (Multiple Lentiviral Expression) Destination vector for use with pMuLE Entry vectors. Co-expresses Neomycin cassette under the control of a PGK promoter. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseLentiviral; Mule gateway destination vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
vDip-C: pAAV-Pcp2-mGreenLantern-KASH
Plasmid#207613PurposevDip-C AAV vector with mouse Pcp2 (also known as L7) promoter driving green fluorophore mGreenLantern with a KASH nuclear membrane tag to isolate cell nuclei of cerebellar Purkinje cellsDepositorInsertmGreenLantern
UseAAVTagsKASHPromotermouse Pcp2 promoter (L7-6)Available SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
mRuby2-Tubulin-C-18
Plasmid#55915PurposeLocalization: Microtubules, Excitation: 559, Emission: 600DepositorAvailable SinceMarch 10, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
BtuF
Plasmid#92209PurposeExpression of BtuF which is the vitamin B12 binding protein for BtuCD ABC TransporterDepositorInsertBtuF (btuF )
Tags6x His Tag and PelB Signal SequenceExpressionBacterialMutationBtuF signal sequence removed and uses the PelB si…PromoterT7 PromoterAvailable SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
FKBP-CD28TMD-NTEVp(H75E)
Plasmid#137829PurposeMESA split-TEV protease chain with FKBP Rapamycin ectodomain, CD28 transmembrane domain, N-terminal H75E mutant TEV proteaseDepositorInsertFKBP-CD28TMD-NTEVp(H75E)
Tags3x FLAGExpressionMammalianMutationMutated Histidine 75 to Glutamic Acid in NTEVp fr…PromoterCMVAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-mTagBFP2-2A-Puro_hU6-RfxDR36-BsmBI
Plasmid#226011PurposeCasRx guide RNA cloning backbone (lenti)DepositorTypeEmpty backboneUseLentiviralAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only