We narrowed to 2,572 results for: GEM
-
Plasmid#139856PurposeLentiviral expression of human DDRGK1-K176R-HADepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pLenti-X1-Neo-DDRGK1-K193R-HA
Plasmid#139857PurposeLentiviral expression of the cDNA indicatedDepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K224R-HA
Plasmid#139858PurposeLentiviral expression of human DDRGK1-K224R-HADepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 RR837-8GG
Plasmid#113958Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationresidues 22-839, R837G and R838G substitutionPromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL1-2
Plasmid#109006PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO hChR2(C128S/D156A)-mCherry
Plasmid#35504PurposeAAV expression of Ef1a-driven, cre-dependent, stabilized step function opsin (SSFO) for optogenetic activation.DepositorInserthChR2(C128S/D156A)-mCherry
UseAAVTagsmCherryExpressionMammalianMutationC128S and D156APromoterEf1aAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
TVBB N-term-mNeongreen
Plasmid#169226PurposeTargeting vector backbone to support a knock-in of mNeongreen-Linker at the N-terminus of a target locusDepositorInsertDouble SapI flanked mNeongreen
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLIB-HIS-TEV-CKS1
Plasmid#177013PurposeGenerate baculovirus for insect cell expression of CKS1 with N-terminal Polyhistidine-TEVDepositorInsertCKS1 (CKS1B Human, Synthetic)
TagsPolyhistidine-TEVExpressionInsectMutationcodon-optimised for insect cell expressionAvailable SinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
hSyn-somBiPOLES-mCerulean
Plasmid#154945PurposeOptogenetic tool for blue-light inhibition and red-light excitation of neuronsDepositorInsertsomBiPOLES
UseAAVTagssoma-targeting motif from Kv2.1 channelExpressionMammalianPromoterhuman synapsinAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO hChR2(C128S/D156A)-EYFP
Plasmid#35503PurposeAAV expression of Ef1a-driven, cre-dependent, stabilized step function opsin (SSFO) for optogenetic activation.DepositorInserthChR2(C128S/D156A)-EYFP
UseAAVTagsEYFPExpressionMammalianMutationC128S and D156APromoterEf1aAvailable SinceApril 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-Tq2CFP-OcsT
Plasmid#71268PurposeEntry clone containing Turqoise2. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertTq2CFP
UseGatewayTags4xGly linker and octaline synthase terminatorAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-GUS-OcsT
Plasmid#71267PurposeEntry clone containing the GUS enzyme. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertBeta-glucuronidase
UseGatewayTags2xGly linker and octaline synthase terminatorAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
MultiMate-Rainbow
Plasmid#206252PurposeExpression of 7 fluorescently labelled proteins in mammalian cells. Can be used to generate recombinant baculovirus particles.DepositorInsertH2B (human); Actin, Tubulin (B. taurus); mito mCherry, GST mTagBFP1 (Synthetic); CyOFP1 (E. quadricolor); Ctnnb1 (mouse)
UseRecombinant baculovirus production (bac-to-bac)TagsiRFP713ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TVBB C-term-mScarlet
Plasmid#169219PurposeTargeting vector backbone to support a knock-in of Linker-mScarlet at the C-terminus of a target locusDepositorInsertDouble SapI flanked mScarlet
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-HLA-cmyc-optiT1R3 a21-852
Plasmid#113949Purposemammalian expression plasmid for c-myc-tagged human codon-optimized human T1R3 with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R3 (TAS1R3 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationresidues 21-852Available SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
TVBB N-term-mTurquoise2
Plasmid#169222PurposeTargeting vector backbone to support a knock-in of mTurquoise2-Linker at the N-terminus of a target locusDepositorInsertDouble SapI flanked mTurquoise2
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
hGFAP-fLuc
Plasmid#40589DepositorInserthGFAP promoter (GFAP Human)
UseLuciferaseTagsFirefly luciferaseMutationContains human GFAP promoter fragment (-2163 to +…PromoterGFAP promoterAvailable SinceSept. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO C1V1 (t/t)-TS-mCherry
Plasmid#35498PurposeAAV expression of Ef1a-driven, cre-dependent, chimeric opsin variant C1V1 (E122T/E162T) for fast and potent optical excitation at red-shifted wavelengths.DepositorInsertChR1-VChR1 Chimera
UseAAVTagsmCherryExpressionMammalianMutationE122T and E162TPromoterEf1aAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HLA-cMyc-EcopT1R1
Plasmid#113962Purposemammalian expression plasmid for c-myc-tagged E. coli codon-optimized human T1R1 with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R1 (TAS1R1 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationtruncate N-terminal 24 residuesAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-C1V1 (t/t)-TS-EYFP
Plasmid#35499PurposeAAV expression of CaMKII-driven chimeric opsin variant C1V1 (E122T/E162T) for fast and potent optical excitation at red-shifted wavelengths.DepositorHas ServiceAAV9InsertChR1-VChR1 Chimera
UseAAVTagsEYFPExpressionMammalianMutationE122T and E162TPromoterCaMKIIaAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO C1V1 (t/t)-TS-EYFP
Plasmid#35497PurposeAAV expression of Ef1a-driven, cre-dependent, chimeric opsin variant C1V1 (E122T/E162T) for fast and potent optical excitation at red-shifted wavelengths.DepositorHas ServiceAAV9InsertChR1-VChR1 Chimera
UseAAVTagsEYFPExpressionMammalianMutationE122T and E162TPromoterEf1aAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
TVBB C-term-mNeongreen
Plasmid#169227PurposeTargeting vector backbone to support a knock-in of Linker-mNeongreen at the C-terminus of a target locusDepositorInsertDouble SapI flanked mNeongreen
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ef1a-DIO-BiPOLES-mCerulean
Plasmid#154949PurposeOptogenetic tool for blue-light inhibition and red-light excitation of neuronsDepositorInsertBiPOLES
UseAAVExpressionMammalianPromoterEf1-alphaAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
hSyn-DIO-BiPOLES-mCerulean
Plasmid#154950PurposeOptogenetic tool for blue-light inhibition and red-light excitation of neuronsDepositorInsertBiPOLES
UseAAVExpressionMammalianPromoterhuman synapsinAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hChR2(C128S/D156A)-mCherry
Plasmid#35502PurposeAAV expression of CaMKII-driven stabilized step function opsin (SSFO) for optogenetic activation.DepositorInserthChR2(C128S/D156A)-mCherry
UseAAVTagsmCherryExpressionMammalianMutationC128S and D156APromoterCaMKIIaAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
TVBB N-term-mScarlet
Plasmid#169218PurposeTargeting vector backbone to support a knock-in of mScarlet-Linker at the N-terminus of a target locusDepositorInsertDouble SapI flanked mScarlet
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFrt-invCAG-ires-Luc
Plasmid#63576PurposeShuttle vector compatible with Flp-mediated (Flp-in) transgene integration that allows for conditional cDNA and Luc expression upon integration. The vector contains an FRT site and two mut loxP sites.DepositorInsertStop-Lox71-IRES-Luciferase-pA-FRT-Lox66-reverseCAG
UseCre/Lox; Frt/flpe recombination mediated insertionExpressionMammalianPromoterCAGAvailable SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 ECD-MHC
Plasmid#113957Purposemammalian expression plasmid for FLAG-tagged human T1R2 ECD with signal peptide of influenza hemagglutinin fused to a canonical transmembrane domain from MHC class IDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG, Signal/leader sequence from influenza hemag…ExpressionMammalianMutationresidues 22-568 fused to a transmembrane tetherPromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV_NFL(K363TAG)-FLAG
Plasmid#182656PurposeExpresses mouse neurofilament light chain with a TAG codon at the position K363 & C-terminal FLAG tag (DYKDDDDK) in mammalian cells. Can be used for amber codon suppression & click labeling of NFL.DepositorInsertmouse neurofilament light chain with a K363TAG mutation (Nefl Mouse)
TagsFLAG tag (DYKDDDDK)ExpressionMammalianMutationK363TAGPromoterCMVAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HLA-c-myc-optiT1R3 ECD
Plasmid#113960Purposemammalian expression plasmid for c-myc-tagged human codon-optimized human T1R3 extracellular domain with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R3 (TAS1R3 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationresidues 21-563PromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
TVBB C-term-mTurquoise2
Plasmid#169223PurposeTargeting vector backbone to support a knock-in of Linker-mTurquoise2 at the C-terminus of a target locusDepositorInsertDouble SapI flanked mTurquoise2
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn1 CaRhGC wt T2A tDimer
Plasmid#101720Purposehumanized, Neuron-specific promoter driven expression of the rhodopsin guanylyl cyclase from Catenaria anguillulae with a neuron-specific promoter. Useful for raising intracellular cAMP close to the mDepositorInsertsCatRhGC
red fluorescent protein
UseAAVExpressionMammalianPromoterhSyn1 and ribosomal skip sequence T2AAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-3xVenusYFP-OcsT
Plasmid#71271PurposeEntry clone containing three repeats of Venus. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsert3 times VenusYFP
UseGatewayTagsoctaline synthase terminatorAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCol1a1-frt (FVB)
Plasmid#63575PurposeTargeting vector for the Col1a1 locus that contains a Neo resistance cassette flanked by FRT sites, followed by an ATG-less Hygromycine resistance gene. The homology arms match the sequence of FVB.DepositorInsertCol1A-frt-hygro-pA
UseMouse Targeting; Frt/flpeExpressionBacterial and MammalianPromoterNoneAvailable SinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
KAT6B-Tol2
Plasmid#113384Purposeevaluate FOXA1 DIV motif enhancer activity near 50 kb of KAT6B geneDepositorInsertKAT6B-enhancer (KAT6B Human)
UseTol2 reporterAvailable SinceSept. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn hBE Rh Guanylyl Cyclase1 2A tDimer
Plasmid#66779PurposeThe rhodopsin-guanylyl cyclase of the aquatic fungus Blastocladiella emersonii enables fast optical control of cGMP signalingDepositorInsertshbeRhGC
red fluorescent protein
UseAAVExpressionMammalianPromoterhuman SynapsinAvailable SinceOct. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 1 CMV EYFP Tubulin
Plasmid#206254PurposeENTR Vector 1 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes EYFP Tubulin under the control of CMV promoter.DepositorInsertEYFP Tubulin
UseMultimate/gateway entr 1TagsEYFPExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 2 CMV mTFP1 Actin
Plasmid#206255PurposeENTR Vector 2 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes mTFP1 Actin under the control of CMV promoter.DepositorInsertmTFP1 Actin
UseMultimate/gateway entr 2TagsmTFP1ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 3 CMV mito mCherry
Plasmid#206256PurposeENTR Vector 3 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes mitochondrially localised mCherry under the control of CMV promoter.DepositorInsertmito mCherry
UseMultimate/gateway entr 3TagsCOX8 mitochondrial tagExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only