We narrowed to 9,707 results for: crispr plasmids
-
Plasmid#121832PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) fused to the p300 catalytic core for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7)/p300core (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro XLone-CCND2
Plasmid#179845Purposedonor plasmid for inducible expression of CCND2 in human cellsDepositorInsertCCND2 (CCND2 Human)
UseCRISPR, Luciferase, and TALEN ; Donor plasmidExpressionMammalianPromoterTRE3GSAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.4.hSyn.flex.H2B.RFP
Plasmid#170386PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 4. Cre-inducible expression of nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.3.hSyn.flex.H2B.RFP
Plasmid#170374PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 3. Cre-inducible expression of nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.3.hSyn.H2B.RFP
Plasmid#170370PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 3. Expressing nuclear RFP.DepositorInsertH2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.13.hSyn.flex.H2B.RFP
Plasmid#170376PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 13. Cre-inducible expression of nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.13.hSyn.H2B.RFP
Plasmid#170372PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 13. Expressing nuclear RFP.DepositorInsertH2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
IP803: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-Dnmt3a3L
Plasmid#121826PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the Dnmt3a-3L DNA methyltransferase for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/Dnmt3a-3L (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KL401: pMAGIC (R4-R3) NLS-(SrfI/PmeI)-NLS-Dnmt3a3L
Plasmid#121840PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS/Dnmt3a-3L scaffold enabling addition of dCas9 mutants into pMAGIC. dCas9 can be inserted via unique SrfI/PmeI restriction sitesDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUDP123
Plasmid#107269PurposepUDP123 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes OpADE2 and OpNIAD and Spcas9D147Y P411T in O. parapolymorpha (HH-gRNAOpADE2-HDV-linker-HH-gRNAOpNIAD-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting OpADE2 and NIAD in O. parapolymorpha
ExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459_GINS4_gRNA
Plasmid#232734PurposeGenerates GINS4 dTAG C ternimal knock-in cell linesDepositorAvailable SinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hCASP8
Plasmid#185378PurposeFor mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8)DepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hARAF-1
Plasmid#185367PurposeFor mammalian expression of guide RNA: caccgTGGTCTACCGACTCATCAAG that targets human ARAFDepositorAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459 VQR
Plasmid#101715PurposesgRNA/Cas9 expression plasmid with Cas9 VQR mutations (NGA PAM)DepositorInsertSpCas9 VQR
Tags3xFLAG-NLS and NLSExpressionMammalianMutationVQR (D1135V, R1335Q and T1337R)Available SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
px459 VRER
Plasmid#101716PurposesgRNA/SpCas9 expression plasmid with Cas9 VRER mutations (NGCG PAM)DepositorInsertSpCas9 VRER
Tags3xFLAG-NLS and NLSExpressionMammalianMutationVRER (D1135V, G1218R, R1335E and T1337R)Available SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
HP17deltaP8
Plasmid#235447PurposeHelper plasmid for regulated phage transferDepositorInsertCoding part of the M13KO7 helper phage genome, except gene VIII
ExpressionBacterialAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
GAL4UAS-Luciferase reporter
Plasmid#64125PurposePhotoactivatable transcription system. Luciferase reporter under the control of the upstream activator sequence (UAS) of Gal4.DepositorInsertGAL4UAS
UseLuciferaseTagsluciferaseExpressionMammalianPromoterGAL4UASAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
Tet-inducible Luciferase reporter
Plasmid#64127PurposePhotoactivatable transcription system. Luciferase reporter under the control of a tet-inducible promoter.DepositorInsertluciferase
UseLuciferaseExpressionMammalianPromoterTetOx13-CMVAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIgnaviCas9
Plasmid#127595PurposeExpresses IgnaviCas9 in E. coliDepositorInsertIgnaviCas9
Tags6xHis Tag and Maltose binding proteinExpressionBacterialPromoterT7 promoterAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgAAVS1
Plasmid#184403PurposepX459 (sgRNA and Cas9 expressing plasmid, RRID:Addgene_62988) with targeting sequence specific to AAVS1; targeting sequence is: GGGGCCACTAGGGACAGGATDepositorInsertAAVS1-specific sgRNA
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only