We narrowed to 9,972 results for: crispr plasmids
-
Plasmid#213035PurposedCas9-VP64 expressed under control of TREDepositorInsertdCas9
UseAAV and CRISPRTagsNLS and NLS-VP64PromoterTRE, miniCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo
Plasmid#139449PurposeLentiviral vector with gRNA scaffold and neomycin selectable markerDepositorInsertno sgRNA inserted; resistance gene: neoR
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-iPEmax-Hygro
Plasmid#214020Purposeinducible PEmax system for controllable prime editing; this plasmid is used to insert PEmax prime editor in one allele of AAVS1 locusDepositorInsertPEmax
ExpressionMammalianPromoterTRE-tightAvailable SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
CMV-SauriABE8e
Plasmid#189927PurposePlasmid encoding SauriABE8e driven by the CMV promoter for plasmid transfection.DepositorInsertSauriABE8e
ExpressionMammalianMutationNme2Cas9 D16APromoterCMVAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV-Nme2ABE8e
Plasmid#189928PurposePlasmid encoding Nme2ABE8e driven by the CMV promoter for plasmid transfection.DepositorInsertNme2ABE8e
TagsNLSExpressionMammalianMutationNme2Cas9 D16APromoterCMVAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV-CjABE8e
Plasmid#189929PurposePlasmid encoding CjABE8e driven by the CMV promoter for plasmid transfection.DepositorInsertCjABE8e
ExpressionMammalianMutationCjCas9 D8APromoterCMVAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
FUGW U6 gL1HSg1dCas9-KRAB-T2a-GFP
Plasmid#234882PurposeL1HS-silencing plasmid (CRISPRi gRNA1)DepositorInsertL1HS-silencing plasmid (CRISPRi gRNA1)
UseCRISPR and LentiviralTagsGFPExpressionMammalianAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-AncBE4max
Plasmid#174164PurposeThis is an AncBE4max (a cytosine base editor) expressing plasmid built on the 3rd generation system of lentiviral vector. It can be used for stable expression of AncBE4max in cells.DepositorInsertAncBE4max
UseLentiviralTagsP2A-mCherryAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO5.U6.DR130(CasRX)_Non-targeting sgRNA.EFS.tRFP657
Plasmid#212962PurposeLentiviral plasmid for the measurement of RfxCas13d (CasRx) nuclease activity. As a marker, the plasmid also encodes the tRFP657 fluorescence protein.DepositorInsertDR1_CasRx_non-targeting spacer
UseCRISPR and LentiviralTagsTagRFP657ExpressionMammalianPromoterU6Available SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO5.U6.DR130(CasRX)_GFP-targeting sgRNA.EFS.tRFP657
Plasmid#212963PurposeLentiviral plasmid for the measurement of RfxCas13d (CasRx) nuclease activity. As a marker, the plasmid also encodes the tRFP657 fluorescence protein.DepositorInsertDR1_CasRx_GFP targeting spacer
UseCRISPR and LentiviralTagsTagRFP657ExpressionMammalianPromoterU6Available SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-iPE2-Hygro
Plasmid#214019Purposeinducible PE2 system for controllable prime editing; this plasmid is used to insert PE2 prime editor in one allele of AAVS1 locusDepositorInsertPE2
ExpressionMammalianPromoterTRE-tightAvailable SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-SA-WTmLdlrEx14-gRNA2-N22-HLP-SACas9-HA-OLLAS-spA
Plasmid#206860PurposeAn AAV plasmid with U6 promoter driving a gRNA against LDLR and liver specific HLP promoter driving SaCas9DepositorInsertmLdlr gRNA (Ldlr Mouse)
UseAAV and CRISPRAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ABE-NT-sgRNA
Plasmid#112734PurposeAAV inverted terminal repeat based vector plasmid encoding E. coli TadA, the N-terminal half of nCas9 and sgRNADepositorInsertABE-NT-sgRNA
UseAAVAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pL90-Nat-2xHO
Plasmid#139069PurposeCRISPR/Cas9 engineering of the HO endonuclease gene with nourseothricin selectionDepositorInsertTwo guide RNAs targeting the HO endonuclease
ExpressionBacterial and YeastPromoterTDH3Available SinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gLacZ.hSyn.H2B.RFP
Plasmid#170369PurposeNegative control plasmid used for Crispr/cas9 based disruption. Expressing nuclear RFP.DepositorInsertH2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
LPUtopia-7_CoV-2
Plasmid#224782PurposeLanding Pad donor vector containing partial RdRp and N gene sequences from SARS-CoV-2 for fluorescent reporter assayDepositorAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
MTOR-F2108L_DARIC(1)_CD19-scFv_AAV6_Donor
Plasmid#211905PurposeVector for AAV6 donor production. Targeted CD19-scFv DARIC transgene integration to the MTOR locus with the dominant rapamycin resistance MTOR-F2108L mutation via homology-directed repair.DepositorInsertDARIC-CD19-scFv
UseAAVExpressionMammalianPromoterhPGK1Available SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
hsLEMD2-pX330
Plasmid#179511PurposeEncodes gRNA for human LEMD2DepositorInsertgRNA for LEMD2
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cas9_nonPuro_OSS
Plasmid#186652PurposeCas9 plasmid to express the Cas9 in OSS cellsDepositorInsertOSS Cas9 Expression Plasmid
ExpressionInsectAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only