We narrowed to 19,814 results for: INO
-
Plasmid#126543PurposeExpresses GFP-tagged FBXL11 in mammalian cellsDepositorAvailable SinceJuly 3, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pGL403
Plasmid#119953PurposeExpresses GPPS and LimS, for the production of GPP and (S)-limonene, in Escherichia coli.DepositorInsertsgpps
limS
ExpressionBacterialMutationN-terminal truncation of 56 amino acid residues (…Available SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSCAR_sgRNA_hygro-tagBFP-lox2272
Plasmid#162078Purpose3rd generation lentivirus sgRNA delivery backbone with Cre-removable tagBFP reporter and hygromycin resistanceDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterU6, EF1aAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pC131: pAAV.CMV-CasRx-VEGFA sgRNA array
Plasmid#203444PurposePlasmid expressing active RfxCas13d with an array of three VEGFA mRNA targeting gRNAsDepositorInsertsU6-VEGFA sgRNA array
RfxCas13d
UseAAVTagsHA and NLSExpressionMammalianPromoterCMV and U6Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-AR Q48
Plasmid#86428PurposeFluorescent human androgen receptor (fused to EGFP) with expanded polyglutamine regionDepositorInsertAndrogen receptor (AR) (AR Human)
TagsEGFPExpressionMammalianMutationPoly-glutamine expansion, G130DPromoterCMVAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-HA-CDK4
Plasmid#172612PurposeExpresses HA-tagged CDK4 in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pExp-xMBP-ACE2-CHis
Plasmid#194998PurposeProduction of ACE2 extracellular domainDepositorAvailable SinceJan. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
Ai66(RCRL-tdT) targeting vector
Plasmid#61578PurposeTarget a Dre and Cre-dependent tdTomato expression cassette to the mouse Rosa26 locusDepositorInsertCAG-RSR-LSL-tdTomato
UseCre/Lox and Mouse TargetingPromoterCAGAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCS2+-N-PAS2-GAF-PHYB-MCherry-CAAX
Plasmid#154910Purpose1-621 amino acids of Arabidopsis PHYB (Gene ID: 816394), tagged with mCherry fluorescence protein and the CAAX membrane moiety. Mammalian codon optimised.DepositorInsertPhytochrome B (PHYB Synthetic, Mustard Weed)
UseXenopus/avian/zebrafishTagsCAAX membrane moiety and mCherryExpressionMammalianMutation1-621 amino acids of Arabidopsis PHYBPromoterCMVAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV_U6-ωRNA*_ISDra2-TnpB-mNG
Plasmid#212968PurposeAAV vector for encoding an ISDra2-TnpB driven by EFs promoterDepositorInsertsISDra2-TnpB-T2A-mNG,
ωRNA*
UseAAV and CRISPRTagsNLS and NLS-FLAGExpressionMammalianPromoterEF1a, T7 and U6Available SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-PSD95-EGFP-WPRE
Plasmid#133785PurposeCre-dependent EGFP Fluorescent reporter for overexpressed postsynaptic marker PSD95 in mammalian cellDepositorAvailable SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Fon-oScarlet
Plasmid#137136PurposeIntersectional viral expression of oScarlet in cells expressing both Cre AND FlpDepositorHas ServiceAAV8InsertCon/Fon-oScarlet
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationE95DPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB-Halo,IRES-eGFP
Plasmid#164519PurposeAll-in-One piggyBac transposon Gateway Destination vector for dox-inducible expression of N-terminal Halo tagged protein (inducible GFP and constitutive rtTA and neomycin resistance)DepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-EYFP
Plasmid#137162PurposeIntersectional viral expression of EYFP in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAdCMV/V5-DEST-Y705F-STAT3-3xFlag
Plasmid#99261PurposeAdenoviral vector encoding Flag-tagged murine STAT3 (Y705F)DepositorInsertSignal transducer and activator of transcription 3 - Y705F (Stat3 Mouse)
UseAdenoviralTags3x-FlagMutationY705F (contains a silent mutation: nucleotide 271…PromoterCMVAvailable SinceJan. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-mOrange/CALR del52
Plasmid#214768PurposeMammalian expression of human CALR del52DepositorAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFastbac1-Flag-FANCD2
Plasmid#134904Purposecodon optimized expression and purification of human FANCD2 in insect cells using baculovirusDepositorInsertFANCD2 (FANCD2 Human)
TagsFlagExpressionInsectMutationfully synthetic, codon optimized for insect expre…PromoterpolyhedronAvailable SinceMarch 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-AR Q0
Plasmid#86427PurposeFluorescent human androgen receptor (fused to EGFP) with deleted polyglutamine regionDepositorInsertandrogen receptor (AR) (AR Human)
TagsEGFPExpressionMammalianMutationDeletion of the poly-glutamine expansionPromoterCMVAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28b-ptetO::bac::gfp
Plasmid#217882Purposeexpresses the bac-BGC in bacterial cells, produces bacillamide DDepositorInsertsDehydrogenase
Non-ribosomal peptide synthetase
Aminotransferase
ExpressionBacterialPromoterptetOAvailable SinceSept. 12, 2024AvailabilityAcademic Institutions and Nonprofits only