-
Plasmid#166542PurposescFv of a human scaffold targeting Leucyl-tRNA synthetase. Antigen coverage aa 260-509 of 1176DepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialMutationPromoterLacZAvailable sinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSP2-bio
Plasmid#47710PurposeExpresses enzymatically monobiotinylated full-length MSP2 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised MSP2
UseTagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable sinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
Sema6d.1-AP-His
Plasmid#72042PurposeExpresses the extracellular region of the Sema6D, isoform 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema6d.1 (Sema6d Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
FUW-ubiquitin-SV40-RFP
Plasmid#65448PurposeExpression of RFP in mammalian cells. Control vector for FUW-Ephrin-RFP vectorsDepositorInsertSV40-RFP
UseLentiviralTagsExpressionMammalianMutationPromoterUBQAvailable sinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Akt-STOPS
Plasmid#175006PurposeAkt Substrate-based Tandem Occupancy Peptide Sponge. Genetically encoded for perturbing cellular Akt kinase activity.DepositorInsertmCherry-Akt-STOPS
UseTags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianMutationPromoterCMVAvailable sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTG-mTDG-K341R
Plasmid#52267PurposeBacterial expression of mouse TDG-K341R with C-terminal GST-tagDepositorInsertTDG (Tdg Mouse)
UseTagsGSTExpressionBacterialMutationK341R, SUMO acceptor site mutationPromoterT7Available sinceJuly 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
Sema4a-Fc-His
Plasmid#72154PurposeExpresses the extracellular region of the Sema4A protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertSema4a (Sema4a Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSncg-0.27kb-EGFP
Plasmid#153185PurposeTruncated mouse gamma-synuclein (mSncg-0.27kb) promoter-mediates gene expression in retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVTagsExpressionMammalianMutationPromoterAvailable sinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA SF-HERC2 F5
Plasmid#55788PurposeExpresses N-terminal 3xFLAG/STREP tagged HERC2 (3550-4450aa)DepositorInsert3xFLAG tagged HERC2 (3550-4450aa) (HERC2 Human)
UseTags3xFLAG and STREPExpressionMammalianMutationPromoterCMVAvailable sinceJuly 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3HA-ErbB4CTF
Plasmid#17803DepositorInsertErbB4 (ERBB4 Human)
UseTagsHAExpressionMammalianMutationCarboxy-terminal fragment, amino acids 676-1292PromoterAvailable sinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
pKrox24(2xD-E)DsRed
Plasmid#200111PurposeFluorescent reporter for in cell monitoring of receptor tyrosine kinase-MAP ERK pathway activityDepositorInsertmodified EGR1 promoter
UseTagsExpressionMammalianMutationhighly modified sequencePromoter2 copies of D-E element, no other promoter elemen…Available sinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
Sema6d.1-Fc-His
Plasmid#72168PurposeExpresses the extracellular region of the Sema6D, isoform 1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertSema6d.1 (Sema6d Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntn4-Fc-His
Plasmid#72106PurposeExpresses the entire Netrin 4 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertNtn4 (Ntn4 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOCC175
Plasmid#118890Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for recombinant protein with N-terminal HIS6-MBP tag, cleavable with 3C, and N-terminal monomeric GFP, cleavable with TEVDepositorInsertNcoI-HIS6-MBP-3C-mGFP-TEV-NotI-ccdB-AscI-stop-HindIII cassette
UseTagsHIS6-MBP, cleavable with 3C protease; mGFP, cleav…ExpressionInsectMutationPromoterpolHAvailable sinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Sema3f(L,+)-AP-His
Plasmid#72021PurposeExpresses the Sema3F protein (truncated at cleavage site P3; ie, long and contains no deletion in exon 3), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema3f (Sema3f Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFastBacDual with LFn + FlaAAA
Plasmid#84867PurposeBaculovirus Expression of LFn-FlaAAA fusion. This is a negative control for LFn FlaA in which the 3 C-terminal leucines have been replaced by alanine.DepositorInsertsLFn
FlaAAA
UseBaculovirusTags6xHisExpressionInsectMutation3 C-terminal leucines have been replaced by alani…PromoterPolyhedrinAvailable sinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLXSN-FLK1 TM
Plasmid#65249PurposeExpression of dominant negative FLK1 in mammalian cellsDepositorInsertFLK1 TM (Kdr Mouse)
UseRetroviralTagsExpressionMammalianMutationdeleted AA 786-1346PromoterLTRAvailable sinceDec. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX nsp1 R99A CoV2
Plasmid#175515PurposeFor protein expression of R99A nsp1 CoV2DepositorInsertR99A nsp1 CoV2
UseTagsGST tagExpressionBacterialMutationPromotertac promoterAvailable sinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only