We narrowed to 13,590 results for: sequence
-
Plasmid#127515PurposePlasmid encodes H. sapiens codon optimized Integrase 7.DepositorInsertIntegrase 7 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianMutationIn 2126 position an G mutated for an T changed th…Available SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC37A3
Plasmid#132107PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC37A3 (SLC37A3 Human)
ExpressionMammalianAvailable SinceDec. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_SLC37A1
Plasmid#132131PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC37A1 (SLC37A1 Human)
ExpressionMammalianAvailable SinceNov. 21, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_SVOPL
Plasmid#132250PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSVOPL (SVOPL Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
TLCV2-Exoc7-Ex5&10
Plasmid#133303PurposeEGFP reporter sequence was removed from TLCV2 vector and two gRNAs targeting mouse Exoc7 gene were cloned into the modified TLCV2 vector.DepositorInsertExocyst complex component 7 (Exoc7 Mouse)
UseCRISPR and LentiviralExpressionMammalianPromotermU6 promoterAvailable SinceNov. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC25A30
Plasmid#132052PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC25A30 (SLC25A30 Human)
ExpressionMammalianAvailable SinceNov. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_SLC25A53
Plasmid#132043PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC25A53 (SLC25A53 Human)
ExpressionMammalianAvailable SinceNov. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_SLC6A7
Plasmid#132208PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC6A7 (SLC6A7 Human)
ExpressionMammalianAvailable SinceOct. 28, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_SLC6A16
Plasmid#132195PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC6A16 (SLC6A16 Human)
ExpressionMammalianAvailable SinceOct. 28, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_SLC25A40
Plasmid#131994PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC25A40 (SLC25A40 Human)
ExpressionMammalianAvailable SinceOct. 22, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_SLC15A5
Plasmid#131922PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC15A5 (SLC15A5 Human)
ExpressionMammalianAvailable SinceOct. 16, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_MPC1L
Plasmid#131918PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertMPC1L (MPC1L Human)
ExpressionMammalianAvailable SinceOct. 15, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET28B-PU.1-ETS-H3/S3
Plasmid#124627PurposeChimeric ETS domain: H3/S3 of Ets-1 in PU.1 scaffoldDepositorTags6xHis tagExpressionBacterialMutationResidues 237 to 241 replaced with corresponding s…Available SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-PARK6e5-I368N
Plasmid#86154PurposeDonor plasmid for PARK6 exon5 I368N sequence. Also contains TagBFP and dTomatoDepositorInsertPINK1 exon 5 homology arms (PINK1 Human)
ExpressionBacterial and MammalianAvailable SinceJune 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-3 SIRT1-NTerm Exon1-Exon3
Plasmid#105681PurposeBacterial Expression construct of N terminus of SIRT1: Exon1-Exon3 (deltaExon2)DepositorInsertSIRT1-NTerm: Exon1-Exon3 (Sirt1 Mouse)
TagsGSTExpressionBacterialMutationSynonymous base changes not affecting the protein…Promotertac_PromoterAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-3- SIRT1-NTerm Exon1-Exon2-Exon3
Plasmid#105680PurposeBacterial Expression construct of N terminus of SIRT1: Exon1-Exon2-Exon3DepositorInsertSIRT1-NTerm: Exon1-Exon2-Exon3 (Sirt1 Mouse)
TagsGSTExpressionBacterialMutationSynonymous base changes not affecting the protein…Promotertac_PromoterAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSIREN-RetroQ-HSPE-sh1
Plasmid#92033PurposepSIREN-RetroQ vector containing shRNA sequence to HPSEDepositorInsertshRNA #1 to HPSE (Hpse Mouse)
UseRetroviralAvailable SinceJuly 19, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSIREN-RetroQ-HSPE-sh2
Plasmid#92034PurposepSIREN-RetroQ vector containing shRNA sequence to HPSEDepositorInsertshRNA #2 to HPSE (Hpse Mouse)
UseRetroviralAvailable SinceJuly 19, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + Z-AAT target
Plasmid#86007Purposelenti reporter plasmid with Z-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
Z-AAT target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + TTR target
Plasmid#86009Purposelenti reporter plasmid with TTR_V30M-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
TTR target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pmirGlo-CALB2-3'UTR delta ARE&mir30
Plasmid#74430PurposeCalb2 UTR with mutated AU binding sequence and mir-30 site 1 and 2DepositorAvailable SinceApril 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
Plxnb2(S)-AP-His
Plasmid#72003PurposeExpresses the N-terminal extracellular region of the PlexinB2 protein following proteolytic cleavage (ie, short), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam4.3-Fc-His
Plasmid#72082PurposeExpresses the extracellular region of the JAM-4, isoform 3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam3-Fc-His
Plasmid#72080PurposeExpresses the extracellular region of the JAM-3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lrrc4-AP-His
Plasmid#71958PurposeExpresses the extracellular region of the LRRC4 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam3-AP-His
Plasmid#71954PurposeExpresses the extracellular region of the JAM-3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam4.1-AP-His
Plasmid#71955PurposeExpresses the extracellular region of the JAM-4, isoform 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam4.3-AP-His
Plasmid#71956PurposeExpresses the extracellular region of the JAM-4, isoform 3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC3A2
Plasmid#132213PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC3A2 (SLC3A2 Human)
ExpressionMammalianAvailable SinceNov. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits