We narrowed to 13,072 results for: BASE;
-
Plasmid#100716PurposeB52 plasmid expressing ATP1A1 sgSTOP (cloned in BsmBI site) and containing an empty sgRNA-expression cassette (use BbsI for cloning)DepositorInsertsgSTOP targeting ATP1A1 (cloned using BsmBI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lck-cpmTq2-Calcium-lifetime-sensor
Plasmid#129627PurposeGenetically encoded calcium sensor (GECI) that reports with lifetime and intensity changesDepositorInsertLck-cpmTq2-Calcium-lifetime-sensor
TagsLckExpressionMammalianPromoterCMVAvailable SinceJune 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hlbCas12a-Nlux
Plasmid#176240PurposepNOC episomal plasmid harboring the humanized lbCas12a gene sequence tagged with Nlux under the control of Ribi promoterDepositorInserthumanized lbCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferasePromoterRibosomal subunitAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-PBZC-Linker-eGFP
Plasmid#176070PurposeEGFP fused to the C-terminus of a PBZ domain & a hygromycin resistance cassetteDepositorInsertPBZ-C
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceFeb. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-PBM-Linker-eGFP
Plasmid#176069PurposeEGFP fused to the C-terminus of a PBM domain & a hygromycin resistance cassetteDepositorInsertPBM
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-HLA-Flag-natT1R2
Plasmid#113947Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from HLA class I …ExpressionMammalianMutationresidues 22-839Available SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-SpdCas9-hHDAC4-tagBFP-PGK-Blasticidin
Plasmid#187954PurposeFKBP12 (F36V mutant) degron-tagged dCas9-hHDAC4 fused to tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-SpdCas9-hHDAC4-tagBFP
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV_dCas9-ZIM3-KRAB_sgTAOK2i_#2
Plasmid#172984PurposeCRISPRi for TAOK2DepositorAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Shank1-GFP KI
Plasmid#131500PurposeEndogenous tagging of Shank1: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_NR1_NR2_LPT1
Plasmid#176253PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and CRISPR array with spacers 1 and 2 targeting the Nitrate reductase gene and one spacer targeting the LPAAT geneDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.H1-NP
Plasmid#134367PurposeNanoluc complementation assay. Expression of histamine receptor H1 fused at C termimus with Natural peptide (NP) of NanoLuc. Addition of the Flag epitope at N terminus of H1 receptor.DepositorInsertH1-NP (HRH1 Human)
TagsFlag and natural peptide of nanoluciferaseExpressionBacterial and MammalianPromoterT7Available SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HLA-cmyc-optiT1R3 a21-852
Plasmid#113948Purposemammalian expression plasmid for c-myc-tagged human codon-optimized human T1R3 with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R3 (TAS1R3 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationresidues 21-852PromoterCMVAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Rims2-GFP KI
Plasmid#131495PurposeEndogenous tagging of RIM2: C-terminal (amino acid position: S1551)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-BG505.SOSIP-QES.i03.c01-8his
Plasmid#111846PurposeMammalian expression plasmid for soluble BG505 SOSIP.664; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 Env (BG505 SOSIP.664)
Tags8his purification tag and CD5 leader sequenceExpressionMammalianMutationCodon-optimized synthetic gene; has SOSIP mutatio…PromoterCMVAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HLA-c-myc-optiT1R3 ECD
Plasmid#113960Purposemammalian expression plasmid for c-myc-tagged human codon-optimized human T1R3 extracellular domain with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R3 (TAS1R3 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationresidues 21-563PromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:MS2:VPR:Tnos (GB1830)
Plasmid#160624PurposeTU for the constitutive expression of the MS2 coat protein fused on Ct to the activation domain VPR (VP64+p65+Rta)DepositorInsertP35S:MS2:VPR:Tnos
ExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVC-DNAJB6b
Plasmid#175065Purposeexpresses mVenus and mCherry tagged DNAJB6b in mammalian cellsDepositorInsertDNAJB6b (DNAJB6 Human)
TagsV5 and mVenus + mCherryExpressionMammalianMutationmVenus: C-Terminal deletion of 11 aa (GITLGMDELYK…PromoterCMV PromoterAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
SOX17-NLS-tdTomato-EPG
Plasmid#210466PurposeDonor plasmid for knock-in NLS-tdTomato into the human SOX17 locusDepositorInsertSOX17 homologous recombination arms with a NLS-tdTomato and EF1alpha-drived puromycin-EGFP selection cassette (SOX17 Human)
UseCRISPRAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET24a-VHH-2xTS
Plasmid#109419PurposeBacterial expression of a functionalized anti-GFP (VHH) nanobody fused to two tyrosine sulfation (TS) motifs. VHH-2xTS also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-GFP nanobody fused to a T7, TS, HA, BAP and His6 epitope
TagsBAP, HA, His6, T7, and Tyrosine sulfation (TS) se…ExpressionBacterialPromoterT7Available SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only