We narrowed to 13,072 results for: BASE;
-
Plasmid#160571PurposeVersion of SgRNA scaffold with the sequence 2.1 of Ms2 aptamer in the 3' end.DepositorInsertsgRNAscaffold 2.1 scRNA
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSW002-Pc-TorT(sp)-mNeonGreen
Plasmid#205021PurposeBroad host-range bacterial expression vector with constitutive Pc promoter. Provides E. coli TorT signal peptide in frame with mNeonGreen (codon optimized for expression in P. fluorescens); for targeting mNeonGreen to the periplasmDepositorInsertTorT-mNeonGreen
ExpressionBacterialMutationmNeonGreen is codon optimized for expression in P…PromoterPcAvailable SinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
mSNX13-PX (558-677)
Plasmid#119094PurposeBacterial expression of human phox homology (PX) domain, mSNX13-PX (558-677)DepositorInsertmSNX13-PX (558-677)
TagsGSTExpressionBacterialPromotertacAvailable SinceApril 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
SNX14-PX (561-686)
Plasmid#119095PurposeBacterial expression of human phox homology (PX) domain, SNX14-PX (561-686)DepositorAvailable SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA NC
Plasmid#176259PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and spacer sequence on sgRNA is replaced by the type IIS restriction site for endonuclease BaeI andDepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pdCas9 (GB1079)
Plasmid#75399PurposeProvides the human codon optimized CDS of Cas9 protein with mutated (D10A, H840A) and inactivated catalytic domains as a level 0 GoldenBraid part for C-terminal fusionsDepositorInsertCas9 coding region with mutated (D10A, H840A) and inactivated catalytic domains (human codon optimised)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPGK-T7/2-CD44v6-10 (-cyt)
Plasmid#137821Purposeexpression of CD44 proteins in mammalian cellsDepositorInsertCD44v6-10 (-cyt) (CD44 Human)
TagsGFPExpressionMammalianMutationwithout cytoplasmic regionPromoterPGKAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
LF701: pMAGIC (L1-R5) hU6::xCas9(3.7) gRNA scaffold
Plasmid#121817PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven xCas9(3.7) (i.e. SpCas9) gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
SNX6-PX (27-171)
Plasmid#119087PurposeBacterial expression of human phox homology (PX) domain, SNX6-PX (27-171)DepositorAvailable SinceApril 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRD421
Plasmid#163112PurposeProduction of His6_TEV-cleavable-linker_mEos3.2_H-NSdbd in BL21 (DE3) pLysSDepositorInsertHis-tag_TEV-cleavable-linker_mEos3.2_H-NSdbd
TagsHis-tag with TEV-cleavable linkerExpressionBacterialPromoterT7 promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 PA-mCit-GW
Plasmid#113448PurposeProteinA-mCitrine Gateway shuttle vector for N-terminal fusionsDepositorTypeEmpty backboneUseGateway shuttle vectorTagsProteinA-mCitrineExpressionMammalianPromoterCMVAvailable SinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [M1_n-1] (GB1210)
Plasmid#75411PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_n-1]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (2-part multiplexing)DepositorInserttRNA-gRNA position [M1_n-1]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
SH3PXD2A-PX (1-126)
Plasmid#119115PurposeBacterial expression of human phox homology (PX) domain, SH3PXD2A-PX (1-126)DepositorAvailable SinceMay 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 a22-end_I132S-S212N
Plasmid#113952Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationdelete N-terminal 21 residues, I132S and S212N su…PromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pST1374-dCas9-GCN4
Plasmid#113026PurposeExpresses dCas9-GCN4 in mammalian cellsDepositorInsertdCas9-GCN4 (GCN4 S. pyogenes, Budding Yeast)
ExpressionMammalianMutationD10A, H840A, N863APromoterCMVAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-Dnmt3a2-Ires2-mCherry-SV40
Plasmid#186969PurposePiggyBac vector encoding mouse Dnmt3a2 with Ires2-mCherry fluorescent marker for expression in mammalian cells.DepositorInsertDnmt3a2 (Dnmt3a Mouse, Synthetic)
UsePiggybacTagsFlagExpressionMammalianMutationIsoform 2 (residues 220–908)PromoterCAGAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 a22-end_I132S-S212N-D231G
Plasmid#113953Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationdelete N-terminal 21 residues, I132S, S212N, and …PromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:MS2:EDLL:Tnos (GB1738)
Plasmid#160622PurposeTU for the constitutive expression of the MS2 coat protein fused on Ct to the activation domain EDLLDepositorInsertP35s_MS2:EDLL_Tnos
ExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only