We narrowed to 15,077 results for: NTS;
-
Plasmid#91129PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:AtCas9_dead + AtU6:gRNA, Plant Selection: 2x35S:hpt IIDepositorInsertEngineering Reagent: 35S:AtCas9_dead + AtU6:gRNA
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
tdp43-EGFP construct10
Plasmid#28203DepositorAvailable SinceSept. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
pJG367
Plasmid#91185PurposeBeYDV replicon T-DNA for gene targeting in tobacco leaves, H840A double nickase (nAtCas9_H840A+gNt_R2+gNt_F2+donor)DepositorInsertnAtCas9_H840A+gNt_R2+gNt_F2+donor
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJG382
Plasmid#91189PurposeBeYDV replicon T-DNA for gene targeting in tobacco leaves, D10A double nickase (nAtCas9_D10A+gNt_R2+gNt_F2+donor)DepositorInsertnAtCas9_D10A+gNt_R2+gNt_F2+donor
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
782 pMEActMEK
Plasmid#31166DepositorAvailable SinceAug. 11, 2011AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hMYOD1 gRNA_multi1-3-MS2-Puro
Plasmid#192683PurposeLentiviral expression of multi gNAs targeting hMYOD1 promoter to activate human MYOD1 transcriptionDepositorInsertHuman MYOD1 activating gRNAs #1,2,3 (MYOD1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
BtGRK2-sYFP2
Plasmid#137778PurposeVisualization of GRK2DepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf42
Plasmid#12730PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf42
ExpressionMammalianAvailable SinceDec. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-GRAB_OTmut
Plasmid#185385PurposeExpresses the genetically-encoded fluorescent oxytocin(OT) control sensor GRAB_OTmut in mammalian cellsDepositorInsertGPCR activation based oxytocin control sensor GRAB_OTmut
ExpressionMammalianPromoterCMVAvailable SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf37
Plasmid#12725PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf37
ExpressionMammalianAvailable SinceDec. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf48
Plasmid#12736PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf48
ExpressionMammalianAvailable SinceDec. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
mWasabi-Mito-7
Plasmid#56508PurposeLocalization: Mitochondria, Excitation: 493, Emission: 509DepositorAvailable SinceJan. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_23D
Plasmid#91141PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers, Plant Selection: 2x35S:barDepositorInsertEngineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-POLArISact
Plasmid#164970PurposeT7 promotor drives in vitro transcription of POLArISact with a human kozak sequenceDepositorInsertPOLArISact
UseIn vitro transcriptionPromoterT7Available SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetO-GFP-mSox2
Plasmid#206374PurposeExpresses EGFP fused mouse SOX2 in mammalian cells, for lentivirus generation.DepositorAvailable SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
tdp43-EGFP construct9
Plasmid#28202DepositorAvailable SinceSept. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
RnBarr1-mTurquoise2
Plasmid#137789PurposeVisualization of beta-arrestin1DepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSG5-ERRbeta-delta10
Plasmid#52187PurposeExpresses human ERRbeta-delta10 splice variant in mammalian cellsDepositorInsertEstrogen-related receptor beta (ESRRB Human)
ExpressionMammalianMutationwild type sequence; codon optimized to exclude Ec…PromoterSV40Available SinceApril 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf196
Plasmid#12884PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf196
ExpressionMammalianAvailable SinceDec. 13, 2006AvailabilityAcademic Institutions and Nonprofits only