We narrowed to 7,796 results for: RAP
-
Plasmid#205920PurposeExpress mEGFP-tagged fusion protein, SETD2_CCDC12 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only
-
CL20_mEGFP_SSR1_FARS2
Plasmid#205930PurposeExpress mEGFP-tagged fusion protein, SSR1_FARS2 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
IL2-mCherry-AHA740D, E758K in pmCherryN1
Plasmid#187285PurposeExpress IL2-AH A740D, E758K-mCherryDepositorTagsmCherryExpressionMammalianMutationAH A740D, E758KPromoterCMVAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ICUE4
Plasmid#181846PurposeFourth-generation FRET-based Indicator of cAMP Using Epac. Genetically encoded cAMP indicator. Contains high-sensitivity Epac Q270E mutation.DepositorInsertICUE4 (RAPGEF3 Human)
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianMutationGlutamine 122 in Epac1 domain mutated to glutamat…PromoterCMVAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-RIα-ICUE4
Plasmid#181848PurposeICUE4 cAMP sensor tethered to the PKA RIα subunit.DepositorTagsECFP, PKA RIα, and cpVenus(L194)ExpressionMammalianMutationGlutamine 122 in Epac1 domain mutated to glutamat…PromoterCMVAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-CD40LG-Fc(DAPA)-AviTag-6xHis
Plasmid#156636PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertCD40LG (CD40LG Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
CTRP-COMP-blac-flag-his
Plasmid#110994PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertcircumsporozoite- and TRAP-related protein (CTRP) (CTRP Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-RnCENP-O-11NS-GFP
Plasmid#205181PurposeExpresses rat CENP-O with 11 mouse-specific point mutations in residues under positive selection; C-term tagged with GFP under T7 promoter - designed for in vitro transcriptionDepositorUseIn vitro transcriptionTags5 glycines linker followed by GFPExpressionMammalianMutationRat CENP-O with 11 mouse-specific point mutations…PromoterT7Available SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
IL2-AH-2A-Cherry-RhoAQ63L in pmCherryN1
Plasmid#187287PurposeExpress pmCherry-IL2-AH-2A-RhoA Q63LDepositorTagsmCherryExpressionMammalianMutationAH-2A-RhoA Q63LPromoterCMVAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
IL2-AHDC2-2A-CherryRhoAQ63L in pmCherryN1
Plasmid#187292PurposeExpress pmCherry-IL2-AH-deltaC2-2A-RhoA Q63LDepositorTagsmCherryExpressionMammalianMutationAH-deltaC2, RhoA Q63LPromoterCMVAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-PDE4D2cat-ICUE4
Plasmid#181847PurposeICUE4 cAMP sensor tethered to the catalytic domain of PDE4D2.DepositorTagsECFP, PDE4D2(86-418), and cpVenus(L194)ExpressionMammalianMutationGlutamine 122 in Epac1 domain mutated to glutamat…PromoterCMVAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac CAG eGFP-PolQ10A-FLAG P2A-BLAST
Plasmid#249812PurposeExpresses the polymerase theta protein fused with N-terminal eGFP and C-terminal FLAG tag and mutated at serines 1289, 1482, 1486, 1488, 1493, 1555, 1563, 1628, 1635 and threonine 1755 into alaninesDepositorInsertPolymerase Theta (POLQ Human)
TagsFLAG and eGFPExpressionMammalianMutationserines 1289, 1482, 1486, 1488, 1493, 1555, 1563,…PromoterCAGAvailable SinceMarch 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
IL2-AHA740D, E758K-2A-Cherry-RhoAQ63L in pmCherryN1
Plasmid#187288PurposeExpress pmCherry-IL2-AH A740D, E758K-2A-RhoA Q63LDepositorTagsmCherryExpressionMammalianMutationAH A740D, E758K, RhoA Q63LPromoterCMVAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-28a-mCherry-MED1-IDR
Plasmid#194545PurposeBacterial Expression of 6xHis mCherry-MED1-IDR Fusion ProteinDepositorAvailable SinceFeb. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP11390-pAAV-DLX2.0-minBG-SYFP2-WPRE3-BGHpA (Alias: CN1390)
Plasmid#163505PurposeDLX2.0 (3xCore version of DLX enhancer). AAV vector for strong & rapid SYFP2 expression in forebrain GABAergic interneurons. The enhancer core has 100% seq conservation between mouse and humanDepositorHas ServiceAAV PHP.eBInsertSYFP2
UseAAVPromoterminBetaGlobinAvailable SinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only