-
Plasmid#128599PurposeEntry vector useful for golden gate or other seamless cloning technique based on Type IIS restriction enzymesDepositorTypeEmpty backboneUseUnspecifiedTagsExpressionMutationPromoterAvailable sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only
-
LI D-E T-Saph + linker c1
Plasmid#54412DepositorInsert16 aa GS linker + T-Sapphire
UseCloning vectorTagsExpressionMutationPromoterAvailable sinceJune 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
SAPDF-pET21a(+)
Plasmid#12649DepositorInsertSA Peptide deformylase
UseTagsHisExpressionBacterialMutationPromoterAvailable sinceJan. 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
pST_AdHsAPO-44 (pBS0746)
Plasmid#185237PurposeFor the mammalian expression of the Chinese giant salamander and human fusion protein AdHsAPO-44. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertAdHsAPO-44
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
LI C-D T-Saphire noATG
Plasmid#54438DepositorInsertT-saphhire without Start codon
UseCloning vectorTagsExpressionMutationPromoterAvailable sinceJune 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
phROSA26-Tet-HA-JSAP1_WT
Plasmid#208772PurposeTetracycline inducible expression vector for HA-JSAP1_WT, used as a donor plasmid for HA-JSAP1_WT knock-in at the human ROSA26 locusDepositorInsertJSAP1 (MAPK8IP3 Human)
UseTagsHAExpressionMammalianMutationPromoterAvailable sinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBetaActin-mNeonGreen-CAMSAP3
Plasmid#191322PurposeExpresses the fluorescently labeled microtubule minus end marker CAMSAP3 to measure microtubule retrograde flowDepositorInsertmNeonGreen-CAMSAP3 (Camsap3 Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUBC-Pfv-Sapphire_PURO
Plasmid#203651PurposeMammalian lentiviral vector for the expression of the Sapphire-tagged 40nm GEM under the UBC promoter, with a puromycin selection marker.DepositorArticleInsertPfV
UseLentiviralTagsSapphireExpressionMutationPromoterAvailable sinceJuly 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneoMyc rat SAPAP1
Plasmid#40215DepositorInsertSAPAP1 (Dlgap1 Rat)
UseTagsmycExpressionMammalianMutationPromoterCMVAvailable sinceNov. 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV rat SAPAP1
Plasmid#47940PurposeExpresses rat SAPAP1 in mammalian cellsDepositorInsertSAPAP1 (Dlgap1 Rat)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceSept. 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
pINO4-Pfv-Sapphire-HO
Plasmid#203659PurposeYeast vector encoding donor DNA for integration of 40nm GEMs into the HO locus.DepositorArticleInsertPfV
UseCRISPRTagsSapphireExpressionMutationPromoterAvailable sinceJuly 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC178: pAAV.U6.SapI.CMV.Cas13bt3
Plasmid#204215PurposePlasmid AAV vector expressing Cas13bt3 and hU6-driven expression of guide RNAs. Contains SapI sites for guide cloning flanked by 5' and 3' full-length DRs.DepositorInsertCas13bt3 and U6.SapI sgRNA cloning site
UseAAV and CRISPRTagsHA and NLSExpressionMammalianMutationCodon optimisation by GenScript toolPromoterCMV/U6Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFasBac+GFP-CAMSAP2
Plasmid#59037Purposefor baculovirus expression of CAMSAP2 in Sf9 cellsDepositorInsertCAMSAP2 (CAMSAP2 Human)
UseTagsHis and eGFPExpressionInsectMutationPromoterAvailable sinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BE4-SsAPOBEC3B
Plasmid#138343PurposeMammalian expression plasmid for BE4-SsAPOBEC3BDepositorInsertBE4-SsAPOBEC3B
UseSynthetic BiologyTagsBP-NLSExpressionMutationPromoterCMVAvailable sinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUBC-Pfv-Sapphire
Plasmid#203649PurposeMammalian lentiviral vector for the expression of the Sapphire-tagged 40nm GEM under the UBC promoter.DepositorArticleInsertPfV
UseLentiviralTagsSapphireExpressionMutationPromoterAvailable sinceJuly 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBetaActin-Halo-CAMSAP3
Plasmid#191329PurposeExpresses the fluorescently labeled microtubule minus end marker CAMSAP3 to measure microtubule retrograde flowDepositorInsertHalo-CAMSAP3 (Camsap3 Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFasBac+GFP-CAMSAP1
Plasmid#59036Purposefor baculovirus expression of CAMSAP1 in Sf9 cellsDepositorInsertCAMSAP1 (CAMSAP1 Human)
UseTagsHis and eGFPExpressionInsectMutationPromoterAvailable sinceSept. 4, 2014AvailabilityAcademic Institutions and Nonprofits only