We narrowed to 1,118 results for: gibson assembly
-
Plasmid#243804PurposeDropout vector for genomic integration into yeast strain LFYalpha. GFP is flanked by BamHI sites for easy cloning using Gibson assembly. Construct contains attB site for the serine recombinase BxB1.DepositorPublicationTypeEmpty backboneUseSynthetic BiologyAvailable sinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only
-
PMXS-GOT1
Plasmid#72872PurposeThe retroviral GOT1 vector was generated by cloning an sgRNA resistant human GOT1 gene block into the pMXS-ires-blast vector by Gibson Assembly.DepositorInsertGOT1 (GOT1 Human)
UseRetroviralExpressionMammalianMutationsgRNA resistant human GOT1, 7 silent mutations c1…Available sinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
plentiCRISPR-sgGOT1
Plasmid#72874PurposeThe lentiviral sgGOT1 vector was generated via ligation of hybridized oligos (below) into lentiCRISPR-v1 vector linearized with BsmBI using Gibson assembly (NEB).DepositorInsertsgGOT1
UseLentiviralAvailable sinceMarch 4, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYZ033
Plasmid#98404PurposeEntry vector for S. pombe CRISPR-Cas9 system. The gRNA can be integrated easily through Gibson Assembly with the plasmid backbone digested by Not1DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable sinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
TOPO mKate2
Plasmid#68441PurposeTOPO construct expressing mKate2 for generation of GMAP-compatible geneDepositorInsertmKate2
UseGmapExpressionBacterialPromoterPlacAvailable sinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
plentiCRISPR-sgMDH1
Plasmid#72875PurposeThe lentiviral sgMDH1 vectors was generated via ligation of hybridized oligos (below) into lentiCRISPR-v1 vector linearized with BsmBI using Gibson assembly (NEBDepositorInsertsgMDH1
UseLentiviralAvailable sinceMarch 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHIV_pTp66p51
Plasmid#78233PurposeExpresses HIV reverse transcriptaseDepositorInsertsp66
p51
LacI
ExpressionBacterialPromoterConst. Promoter (From DNA2.0 Vec) and pTac Minima…Available sinceAug. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBIG1a
Plasmid#80611PurposepBIG1a - Step1 vector a (biGBac system for expression of protein complexes in insect cells)DepositorTypeEmpty backboneExpressionInsectAvailable sinceOct. 20, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLIB
Plasmid#80610PurposepLIB - Library vector (biGBac system for expression of protein complexes in insect cells)DepositorTypeEmpty backboneExpressionInsectPromoterpolyhedrinAvailable sinceOct. 20, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pWM_12x601_25bpLinker
Plasmid#157788PurposeEcoRV digestion produces 12x601 chromatin assembly construct with 25 bp linker lengths in addition to carrier DNA that prevents overassembly of nucleosomesDepositorInsert12x601_25bp linker
ExpressionBacterialAvailable sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pENTR_HA-spGFP11
Plasmid#240224PurposeGateway entry clone for cloning in insert sequences by gibson assembly to create a C-terminal HA-spGFP11 tag. No ATG start codon.DepositorTypeEmpty backboneUseGateway shuttle vectorAvailable sinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
p006-GFP-pBAD
Plasmid#108315PurposeGFP from jellyfish Aquorea sp. under pBAD promoter with AraC repressor; kanamycin resistant.DepositorPublicationInsertGFP under control of arabinose-inducible promoter pBAD
ExpressionBacterialPromoterpBADAvailable sinceAug. 17, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLV_3XHA-ATP6V1B2-mNeonGreen
Plasmid#228865PurposeStable expression of V-ATPase subunit ATP6V1B2 with N-terminal 3xHA and C-terminal mNeonGreenDepositorAvailable sinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
TOPO Cre-2A-GFP
Plasmid#68450PurposeTOPO construct expressing Cre-2A-GFP for generation of GMAP-compatible geneDepositorInsertCre-2A-GFP
UseGmapExpressionBacterialPromoterPlacAvailable sinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV_3xFLAG-ATP6V0A3-mScarlet
Plasmid#228867PurposeStable expression of V-ATPase subunit ATP6V0A3 with N-terminal 3xFLAG and C-terminal mScarletDepositorAvailable sinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBIG2ab
Plasmid#80616PurposepBIG2ab - Step2 vector ab (biGBac system for expression of protein complexes in insect cells)DepositorTypeEmpty backboneExpressionInsectAvailable sinceOct. 20, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBIG1b
Plasmid#80612PurposepBIG1b - Step1 vector b (biGBac system for expression of protein complexes in insect cells)DepositorTypeEmpty backboneExpressionInsectAvailable sinceOct. 20, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
STAGR_gRNAScaffold_hU6
Plasmid#102840PurposeCan be used as PCR template for a STAgR reactionDepositorInsertgRNAScaffold_hU6promoter
PromoterhU6Available sinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUCC001
Plasmid#124451PurposeMulti-species CRISPR/Cas9 coexpression system, optimized for Golden Gate cloning of gRNA targetsDepositorInsertHH-BsaI
ExpressionYeastMutationgRNA expression cassette from pUDP002 modified to…PromoterTDH3 promoter from S.cerevisiae (already present …Available sinceSept. 26, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available sinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only