We narrowed to 1,009 results for: dTomato
-
Plasmid#85847PurposeDonor plasmid for SNCA exon3 wild type sequence. lso contains TagBFP and dTomatoDepositorInsertSNCA exon 3 homology arms (SNCA Human)
ExpressionBacterial and MammalianAvailable sinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-FLEX-fwd[Chrimson-tdT]
Plasmid#59137PurposeExpression vector for Chrimson-tdTomato in a floxed/forward-reading, Cre-dependent manner (Cre turns gene off)DepositorInsertChrimson-tdTomato
UseCre/LoxTagstdTomatoExpressionMammalianPromoterCAGAvailable sinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Ai27
Plasmid#34630PurposeCre-dependent expression of hChR2(H134R)-tdTomato, for optogenetic excitationDepositorInsertFloxed hChR2(H134R)-tdTomato
UseMouse TargetingTagstdTomatoMutationHis 134 has been mutated to ArgPromoterCAGAvailable sinceFeb. 29, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
CAG-loxP-3xpA-loxP-H2B-sfGFP+pCI syntron-T2A-tdTomato+RbG and HsbG syntrons
Plasmid#172480PurposeH2B-sfGFP with a synthetic intron from the pCI expression vector, T2A, and tdTomato with synthetic introns derived from the rabbit beta-globin gene and the human beta-globin geneDepositorInsertH2B-sfGFP-T2A-tdTomato
UseCre/LoxExpressionMammalianAvailable sinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynaptoTAG2
Plasmid#175275PurposeAAV vector for mapping synaptic projections of infected neurons; expresses tdTomato to reveal neuronal soma and axons, and expresses EGFP fused to Synaptobrevin-2 to track synaptic terminals.DepositorInsertEGFP-Synaptobrevin-2; tdTomato (Vamp2 )
UseAAVTagsEGFP and tdTomato (P2A cleavage)PromoterSynapsinAvailable sinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Ai139 (TIT2L-GFP-ICL-TPT) targeting vector
Plasmid#114426PurposeTarget a Cre-dependent GFP and a tdTomato-P2A-tTA2 expression cassette into the mouse TIGRE locusDepositorInsertGFP, tdTomato, tTA2,
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable sinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV pCAG-FLEX-mScarlet-WPRE
Plasmid#99280PurposeCan be used to generate AAV virus that will express mScarlet in the presence of CreDepositorInsertmScarlet
UseAAV and Cre/LoxAvailable sinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGFAP::MyrTomato
Plasmid#22671DepositorInsertmyrtdTomato
ExpressionMammalianMutationGfa2 human GFAP promoterAvailable sinceJan. 21, 2010AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Ai62(TITL-tdT) Flp-in replacement vector
Plasmid#61576PurposeRecombinase-mediated cassette exchange in ES cells to insert a Cre & tTA-dependent tdTomato expression cassette into a docking site within the mouse TIGRE genomic locusDepositorInsertchromatin insulator flanked TRE-LSL-tdTomato
UseRecombinase-mediated cassette exchange using flp …Available sinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBT264
Plasmid#27438DepositorInsertTRE-tdTomato-myc flanked by insulators
UseMouse Targeting; Tta dependentTagsMycAvailable sinceMarch 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
LeGO-iT
Plasmid#27361DepositorPublicationInsertU6 promoter, SFFV promoter, IRES-tdTomato
UseLentiviralExpressionMammalianAvailable sinceApril 24, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBT268_(pCA-ATG-intron-tTA2-iiTRE-tdT3Mycii)
Plasmid#36880DepositorInsertstTA2
tdT-3Myc
insulator
Tags3 Myc tagsExpressionMammalianMutationinsertion of a beta-globin intron with a loxP sit…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available sinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pME-BrainbowTEC
Plasmid#82405PurposeGateway-compatible Brainbow-1.0 with fluorophores tdTomato-myc/EGFP/E2Crimson-HADepositorInsertstdTomatoMYC fusion
EGFP
E2CrimsonHA
TagsHA and MYCAvailable sinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
eMscL G22S
Plasmid#107455PurposeeMscL G22S is optimized for mammalian rodent neuronal expression to the plasma membrane through a neuron-specific promoter and a voltage-gated channel targeting motifDepositorInsertbacterial mechanosensitive ion channel of large conductance (mscL Escherichia coli)
UseAdeno-associated viralTagsKir2.1 ER export signal (FCYENEV) and tdTomato fl…ExpressionMammalianMutationBearing a glycine to serine substitution at posit…Promoterhuman synapsin 1Available sinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Fireworks RFP[PTC-] (AVA2515)
Plasmid#85443PurposeExpresses TEV protease and tandemly-repeated RFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of a beta-globin reporter.DepositorInserttDNA1 EF1alfa-5xtdTomato-TEVprotease-PEST-beta-globin(dI1)-BGH polyA tDNA2 FRT-HygromycinR
UseMinimal backbone fragment for low-copy bacterial …ExpressionMammalianAvailable sinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1955
Plasmid#84830PurposeMinimos transposon with Peft-3:tdTomato:tbb-2 3'UTR and cbr-unc-119 selection. tdTomato was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and synthetic intronsDepositorInsertC. elegans codon optimized tdTomato
ExpressionBacterial and WormPromoterPeft-3Available sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Ai66(RCRL-tdT) targeting vector
Plasmid#61578PurposeTarget a Dre and Cre-dependent tdTomato expression cassette to the mouse Rosa26 locusDepositorInsertCAG-RSR-LSL-tdTomato
UseCre/Lox and Mouse TargetingPromoterCAGAvailable sinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-PSD95-EGFP-WPRE
Plasmid#133785PurposeCre-dependent EGFP Fluorescent reporter for overexpressed postsynaptic marker PSD95 in mammalian cellDepositorAvailable sinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDRF1-GW yAT1.03
Plasmid#132781PurposeFRET biosensor for ATP measurements in budding yeastDepositorInsertyAT1.03 ymTq2-tdTomato
ExpressionYeastAvailable sinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M-tdTom-SP
Plasmid#48677PurposeMammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
UseCRISPRPromoterSp6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by