We narrowed to 15,882 results for: LEA
-
Plasmid#191206PurposeGFP expression under the control of TRE promotorDepositorInsert3X GFP
UseAAVExpressionMammalianPromoterTREAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBactin-AcGFP-128-425-Akap9
Plasmid#196871PurposeExpression of fragment 128-425 from A-Kinase Anchoring Protein 9 (Akap9) fused to AcGFP. Used to displace endogenous Akap9 from GolgiDepositorInsertAcGFP-Akap9 (128-425) (Akap9 Rat)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLED.NPL
Plasmid#193014PurposeNeuron-specific reporter (CBh promoter, Pls3 exon, bichromatic reporter)DepositorInsertBichromatic reporter (EGFP and dsRed-Express2)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-TO/CMV-puro-DD-PAmCherry1-KRas G12D
Plasmid#177320PurposeLentiviral vector expressing PAmCherry1-tagged KRas 4B G12D mutant, with an N-terminal dimerization domain (DD).DepositorInsertKRAS 4B (KRAS Human)
UseLentiviralTagsFKBP-derived dimerization domain (DD, or DmrB) an…ExpressionMammalianMutationG12DPromoterTetOn-CMVAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
t1-435
Plasmid#166578PurposeFor expression of human talin head (residues 1-435) in E. coli. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertTln1 Head (1-435) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 1-435 onlyAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBIG1e-CDK12/Cyclin K
Plasmid#231730PurposeProtein expression in insect cellsDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBIG1e-CDK13/Cyclin K
Plasmid#231731PurposeProtein expression in insect cellsDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB-Tet-On-HTR6-RhoA sensor
Plasmid#189614PurposeTet-On cilia-targeted RhoA sensor (Xlone piggybac back-bone); HTR6-fused with a sGFP-mScarlet-I based sensorDepositorAvailable SinceMarch 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetON)(TRE-SEAP
Plasmid#210513Purposeexpresses PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetON and SEAP reporter in mammalian cellsDepositorInsertssecreted alkaline phosphatase
CMV-PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq
TagsMycExpressionMammalianPromoterCMV and TetOAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3Basic_ME.1/ApoEpromoter
Plasmid#51435PurposeThis plasmid is a luciferase-based reporter construct to measure the activity of the ApoE promoter fused to ME.1 enhancerDepositorUseLuciferaseExpressionMammalianMutationME.1 enhancer is fused upstream of ApoE promoter …Available SinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Puro-HEK3 CTT ins
Plasmid#171996PurposeDelivers all prime editing (nickase) components targeting the HEK3 site for a CTT inserrtion, in a single, puromycin selectable plasmidDepositorInsertCbH-Cas9(H840A)-RT-T2A-Puro, hU6-pegRNA HEK3 CTT ins, hU6-sgRNA HEK3 +90
ExpressionMammalianPromoterCMV for Cas9, U6 for gRNAsAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-ePhi29(+exo) (LM2990)
Plasmid#208958PurposeA variant CE1 construct with ePhi29 DNA polymerase (exo active), expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-ePhi29(+exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); ePhi29(M8R/V51A/M97T/G197D/E221K/…PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRIPZ-bioGEF-SUMO1nc-PURO
Plasmid#208042PurposeEnables inducible expression of low-affinity Avitag-SUMO1nc; to perform bioE3; nc = non-cleavable mutation; selection with puromycinDepositorInsertSUMO1nc (SUMO1 Human)
UseLentiviralTagsLow-affinity AvitagMutationQ94P Mutation near C-terminus suppresses cleavage…PromotertetO/UBCAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
ATX3-77Q
Plasmid#184249PurposeRecombinant protein expression and purification. Encodes ataxin-3 full length with 3 UIMs and 77Q in the Poly-Q track fused with His-Tag and TEV cleavage sequence (N-terminal)DepositorInsertAtaxin-3 full length with 3 UIMs and 77Q in the Poly-Q track (ATXN3 Synthetic, Human)
Tags6x His-Tag and TEV cleavage siteExpressionBacterialMutationCodon optimization for protein expression in BL2…PromoterT7 promoterAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Halo-Tag-128-425-Akap9
Plasmid#196873PurposeExpression of fragment 128-425 from A-Kinase Anchoring Protein 9 (Akap9) fused to Halo-Tag. Used to displace endogenous Akap9 from GolgiDepositorAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLED.GluA2
Plasmid#193017PurposeGluA2 (Gria2) flip/flop reporter (hSyn promoter, Gria2 flip/flop exons, bichromatic reporter)DepositorInsertBichromatic reporter (EGFP and dsRed-Express2)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLED.ENS
Plasmid#193016PurposeExcitatory neuron-specific reporter (hSyn promoter, Synrg exon, bichromatic reporter)DepositorInsertBichromatic reporter (EGFP and dsRed-Express2)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-DIO-inv[roxSTOProx-EB3 mNeonGreen-bGH]
Plasmid#196885PurposeDual Cre/Dre-dependent expression of EB3-mNeon. Used as functional (labelling of microtubule plus ends) Cre-Dre cotransfection reporterDepositorInsertroxSTOProx-EB3 mNeonGreen-bGH (MAPRE3 Human)
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-(Spyo_Cas9)-6xHis-NLS(SV40)
Plasmid#185706PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(Spyo_Cas9) with an N-terminal NLS and C-terminal NLSDepositorInsertCas9
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only