We narrowed to 10,501 results for: ada
-
Plasmid#179988PurposeMammalian expression vector for RaTG13 ORF3a, V5-tagged. Sequence codon-optimized.DepositorInsertRaTG13 ORF3a
ExpressionMammalianMutationhuman codon-optimizedAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
ptdTHC_PGKneoLox2DTA.2
Plasmid#112625PurposeH2BtdTomato_p2A_HygroR_p2A_CreERt2 targeting plasmid with cloning sites ready for homology armsDepositorInsertsUseCre/Lox and Mouse TargetingTagstdTomatoPromoterNo PromoterAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCG_SARS-CoV2 NSP15 C-V5-tag
Plasmid#179975PurposeMammalian expression vector for SARS-CoV-2 Nsp15, V5-tagged. Sequence codon-optimized.DepositorAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
BCL6-GFP G55A in Artichoke
Plasmid#169935PurposeOverexpression of BCL6-GFP G55A mutant fusionDepositorAvailable SinceJuly 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Myc-FBW7 Delta F-Box
Plasmid#197452PurposeThe plasmid expresses F-box deleted version of Myc-tagged FBW7 human isoform 1. Used for mammalian overexpression of FBW7alpha delta-F-Box and detection by western blotting.DepositorAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pnEA-vH_His-TEV-SEPT2-sfCherry2_SEPT6
Plasmid#180313Purposebacterial co-expression of human SEPT2 fused to superfolder Cherry2 and of human SEPT6DepositorTagsHis6-TEV and sfCherry2ExpressionBacterialAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-hCCND1-T286A-HA
Plasmid#174155PurposeLentiviral vector expressing HA-tagged human cyclin D1 with T286A mutationDepositorInsertCCND1 (CCND1 Human)
UseLentiviralTagshemagglutinin (HA)ExpressionMammalianMutationA>G at base 856 (Thr>Ala at amino acid 286)PromoterEF1AAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-V5-SHLD3
Plasmid#114124PurposeExpresses N-terminally tagged V5-SHLD3 in mammalian cellsDepositorInsertSHLD3 (SHLD3 Human)
UseGenomic integration, tetracycline inducibleTagsV5ExpressionMammalianPromoterCMV/TetO2Available SinceAug. 23, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
8047_GFP-Kras2B_ires_puro
Plasmid#64371PurposeThis a retroviral expression plasmid expressing GFP tagged wild type Kras 2B oncogene along with puro resistance geneDepositorAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
DHC1-AID-Clover donor (Neo)
Plasmid#158621PurposeDonor plasmid for tagging DHC1 with AID-CloverDepositorInsertDHC1 (DYNC1H1 Human)
UseCRISPR; Tagging donorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-NOTCH3(Trunc1)-Fc(DAPA)-AviTag-6xHis
Plasmid#157045PurposeMammalian expression of cell-surface protein partial extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertNOTCH3 (NOTCH3 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiMutB3GALT5catdead-blast
Plasmid#220869Purposelentiviral vector for expressing human B3GALT5 with D156A and D243A inactivating mutations and C-terminal myc-DDK tag, includes nucleotide change in PAM targeting sequenceDepositorInsertbeta-1,3-galactosyltransferase 5 (B3GALT5 Human)
UseLentiviralTagsmyc, FLAGExpressionMammalianMutationencodes D156A and D243A mutations; also, nucleoti…Available SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-VHC
Plasmid#112618Purposeexpression plasmid with CAG promoter driving multicistronic cassette H2BVenus_p2A_HygroR_p2A_CreERt2DepositorInsertsTagsVenusExpressionMammalianPromoterCAGAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-H2B-iRFP670-p2a-YFP-Rb-IRES-blasticidin
Plasmid#223962PurposeDual fluorescent reporter for histone H2B and for exogenous RbDepositorTagsYFP and iRFP670ExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-(Spyo_Cas9)-6xHis-NLS(SV40)
Plasmid#185706PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(Spyo_Cas9) with an N-terminal NLS and C-terminal NLSDepositorInsertCas9
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 KBTBD4 R313PRR
Plasmid#184626PurposeDoxycycline inducible lentiviral vector for N-terminal Flag tagged KBTBD4 R313PRR expression in mammalian cellsDepositorInsertN-terminal Flag tagged KBTBD4 R313PRR (KBTBD4 Human)
UseLentiviral; Doxycycline inducibleExpressionMammalianMutationR313PRRPromoterTRE promoter, Tet ONAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-scFVDnmt3AL_bGHpA
Plasmid#177347PurposeAAV expression of a fusion protein with scFV, catalytic domain of Dnmt3a and C terminal domain of Dnmt3l for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsC-terminal domain of mouse Dnmt3l (194–415 aa), P…ExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterCMVAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-scFVtet1_bGHpA
Plasmid#177351PurposeAAV expression of scFV-fused catalytic domain of TET1 for targeted DNA methylation editingDepositorInsertTet Methylcytosine Dioxygenase 1 (TET1 Human)
UseAAVTagsmyc and scFVExpressionMammalianMutationN terminal domain of human Tet1PromoterCMV promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEN-L1-K2-L2
Plasmid#80684PurposeGateway Entry vector containing a temperature-sensitive mouse DHFRDepositorUseSynthetic BiologyTags3xHAExpressionBacterial, Insect, Mammalia…Mutationmouse DHFR with N-terminal UbiquitinAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only