We narrowed to 8,330 results for: gnal
-
Plasmid#181974PurposeExpresses anti-CD19 CAR (with CD28 signaling domain) linked to puromycin resistance via P2A and to human truncated NGFR via T2A for lentiviral delivery.DepositorInsertFMC6.3-28z CAR; tNGFR (NGFR Synthetic, Human)
UseLentiviralTagsExpressionMutationNGFR truncation: aa 11-276PromoterAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-C1 actin-3XNLS P2A mCherry
Plasmid#58475PurposeExpresses nuclear-targeted human actin, with an mCherry expression reporter after a P2A protease cleavage site, on a CMV promoterDepositorInsertsUseTagsmCherryExpressionMammalianMutationPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-C1 R62D actin-3XNLS P2A mCherry
Plasmid#58477PurposeExpresses nuclear-targeted non-polymerizing R62D mutant of human actin, with an mCherry expression reporter after a P2A protease cleavage site, on a CMV promoterDepositorInsertsUseTagsmCherryExpressionMammalianMutationChanged Arginine 62 to Aspartic AcidPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-rc [Chronos-tdTomato]
Plasmid#84484PurposeAAV-mediated expression of Chronos-tdTomato under the CAG promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal. tdTomato is a codon diversified version.DepositorInsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianMutationPromoterCAGAvailable SinceApril 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
-
GPER-DuET
Plasmid#213256PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-ChrimsonR-tdTomato
Plasmid#99231PurposeAAV-mediated expression of ChrimsonR-tdTomato under the CaMKII promoter. tdTomato has codons varied between the first and second tandem repeats to reduce recombination. Using SV40 signal.DepositorInsertChrimsonR-tdTomato
UseAAVTagstdTomatoExpressionMammalianMutationChrimson K176R mutantPromoterCaMKIIAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Chronos-tdTomato
Plasmid#62726PurposeAAV-mediated expression of Chronos-tdTomato under the Syn promoter. Using bGHpA signal. tdTomato has codons varied between the first and second tandem repeats to reduce recombination.DepositorHas ServiceAAV8InsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianMutationPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.V5.VSVg_NGFR
Plasmid#158244PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.V5.VSVgExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc [ChrimsonR-GFP]
Plasmid#84480PurposeAAV-mediated expression of ChrimsonR-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChrimsonR-GFP
UseAAVTagsGFPExpressionMammalianMutationChrimson K176R mutantPromoterhuman synapsin promoterAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP
Plasmid#112677PurposeAn AAV vector that expresses a Cre-dependent nuclear-localized Red to Green Fluorescent proteinDepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertNuclear-localized floxed-mCherry EGFP
UseAAVTagsNuclear localization signalExpressionMutationPromoterEF1aAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
CXCR4-DuET
Plasmid#213221PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
iChr2-Notch Mosaic (SO250)
Plasmid#99752PurposeSecond generation Rosa26 gene targeting vector to induce a Cre-dependent mosaic of cells expressing different chromatin localized fluorescent proteins and Notch signalling genesDepositorInsertHIs-H2B-Cherry, H2B-EGFP-V5, HA-H2B-Cerulean, DN-Maml1, NICD-PEST
UseCre/Lox and Mouse TargetingTagsExpressionMammalianMutationPromoterAvailable SinceOct. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
CCR6-DuET
Plasmid#213202PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[Chronos-GFP]
Plasmid#62722PurposeAAV-mediated expression of Chronos-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianMutationPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.V5.FLAG_NGFR
Plasmid#158250PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.V5.FLAGExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Archon1-KGC-GFP-ER2
Plasmid#115892PurposeAAV-mediated expression of Archon1-KGC-GFP-ER2 under the Syn promoter. Using bGHpA signal.DepositorHas ServiceAAV8InsertArchon1-KGC-EGFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianMutationPromoterSynAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-PPO-Venus
Plasmid#139505PurposeAAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the Ef1a promoter. Used for photoswitchable control of inhibitory GPCR signaling cascades.DepositorHas ServiceAAV8 and AAV9Insertparapinopsin
UseAAVTagsVenus tag following 3x Ala linkerExpressionMammalianMutationPromoterEf1aAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only