We narrowed to 24,457 results for: promoter
-
Plasmid#85530PurposeInducible expression of guide RNA (huMcl-1.1) with fluorescent GFP reporterDepositorAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pENTR1a-mCherry-STIM1
Plasmid#114176PurposeGateway entry clone containing mCherry-STIM1DepositorAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_Std_BFP-to-EGFP_Dual_epegRNA_tevopreQ1
Plasmid#187459PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 pegRNA and EBFP_To_EGFP epegRNA (tevopreq1) from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + EBFP to EGFP epegRNA (tevopreq1) (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-CD86-SmBiT
Plasmid#223618PurposeLentiviral expression of human CD86 with SmBiT tag in mammalian cellsDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX317 CALM2
Plasmid#193684PurposeConstitutive lentiviral expression of CALM2DepositorInsertCALM2 (CALM2 Human)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
HA-Rab8a-DN (T22N)
Plasmid#101049PurposeExpresses HA-tagged human Rab8-DN (T22N) in mammalian cellsDepositorAvailable SinceOct. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
LZRS-Flag_EZH2_ER
Plasmid#26111DepositorAvailable SinceJan. 31, 2011AvailabilityAcademic Institutions and Nonprofits only -
GFP-BRPF3
Plasmid#65383PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAcUW51-gEgIL
Plasmid#11622DepositorInsertHSV-1 glycoprotein E and HSV-1 glycoprotein I
TagsHisExpressionInsectMutationDicistronic vector containing HSV-1 gE (KOS strai…Available SinceApril 6, 2007AvailabilityAcademic Institutions and Nonprofits only -
pGL410-BRN2p
Plasmid#110733PurposeLuciferase reporter for the human BRN2 promoterDepositorAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 3
Plasmid#51762PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 3
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
LZRS ERTm RasV12
Plasmid#21199DepositorAvailable SinceJuly 24, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLEX303-ARF6-mNeonGreen
Plasmid#162027PurposeExpression of tagged ARF WTDepositorInsertARF6 (ARF6 Human)
UseLentiviralAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTarget: Ptaq-RFP_PlacIq-GFP
Plasmid#192280PurposeRFP expressed under constitutive promoter Ptaq and GFP expressed under constitutive promoter PlaciqDepositorInsertsRFP
GFP
ExpressionBacterialPromoterPlacIq and PtaqAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-SwitchON-sgVRK1
Plasmid#199638PurposeTamoxifen-inducible expression of sgRNA targeting VRK1DepositorInsertN/A (VRK1 Human)
UseLentiviralAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
ASC-CASP1 Octamer
Plasmid#164032PurposeBacterial expression vector encoding a 5GSS-linked ASC(CARD)-CASP1(CARD) construct to express an octamerDepositorTagsHis6-MBP-TEVExpressionBacterialMutationW169G (ASC), G20K (CASP1)Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiCas9-sgVRK1 #1-Blast
Plasmid#199646PurposeExpresses Cas9 and sgRNA guide targeting VRK1DepositorInsertN/A (VRK1 Human)
UseLentiviralAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDN-D2irTNG4kwh
Plasmid#44722DepositorInsertspCMV-D2i promoter
htetR::NLS::EGFP
UseSynthetic Biology; Expression regulator/reporter;…TagsRabbit β-globin intron II and WPREExpressionMammalianMutationInitiator motif (Inr) displaced relative to pCMV-…PromoterpCMV-D2iAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-TRE3G-PLOD2_PGK-GpNLuc
Plasmid#136457PurposeExpresses Tet/Dox-inducible human PLOD2 in mammalian cells.DepositorInsertTRE3G::PLOD2-T2A-Hygromycin (PLOD2 Human)
UseLuciferase and RetroviralExpressionMammalianPromoterTRE3GAvailable SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only