We narrowed to 3,594 results for: cmv promoter
-
Plasmid#134333PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA17_Efa with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA17_Efa
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA17_Sga-NLS(SV40) (KAC92)
Plasmid#134334PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA17_Sga with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA17_Sga
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA18_Sma-NLS(SV40) (KAC95)
Plasmid#134335PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA18_Sma with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA18_Sma
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA19_Ssim-NLS(SV40) (KAC97)
Plasmid#134336PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA19_Ssim with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA19_Ssim
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA18_Sga-NLS(SV40) (KAC214)
Plasmid#134338PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA18_Sga with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA18_Sga
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA19_Spse-NLS(SV40) (KAC215)
Plasmid#134339PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA19_Spse with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA19_Spse
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA1-NLS(SV40) (KAC478)
Plasmid#133795PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA1 with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA1
TagsNLS(SV40)ExpressionMammalianMutationn/aPromoterCMV and T7Available SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKG2438_pGEEC534_pShip-CMV-mRuby2-P2A-PuroR-bGH
Plasmid#239730PurposePlasmid expressing mRuby2 and PuroR with the CMV promoterDepositorInsertmRuby2-P2A-PuroR
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJB002 CMV 3xFLAG-NLS-DsDed-ZF1
Plasmid#161532PurposeConstitutive expression ofCMV 3xFLAG-NLS-DsDed-ZF1 under the CMV promoterDepositorInsert3xFLAG-NLS-DsDed-ZF1
UseSynthetic BiologyTags3x-FLAGExpressionMammalianPromoterCMVAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 Y74E-WPRE
Plasmid#250385PurposeLentiviral expression of human NUDT5 Y74E with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 P158T-WPRE
Plasmid#250383PurposeLentiviral expression of human NUDT5 P158T with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTags2xHAExpressionMammalianMutationP158TPromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 P66L-WPRE
Plasmid#250378PurposeLentiviral expression of human NUDT5 P66L with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 G150V-WPRE
Plasmid#250381PurposeLentiviral expression of human NUDT5 G150V with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTags2xHAExpressionMammalianMutationG150VPromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 C76Y-WPRE
Plasmid#250379PurposeLentiviral expression of human NUDT5 C76Y with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 K175M-WPRE
Plasmid#250384PurposeLentiviral expression of human NUDT5 K175M with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTags2xHAExpressionMammalianMutationK175MPromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-tagBFP-NUDT5 E112Q-WPRE
Plasmid#250376PurposeLentiviral expression of human NUDT5 carrying E112Q mutation with N-terminal tagBFP under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTagstagBFPExpressionMammalianMutationE112QPromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 Y74F-WPRE
Plasmid#250380PurposeLentiviral expression of human NUDT5 Y74F with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 P158I-WPRE
Plasmid#250382PurposeLentiviral expression of human NUDT5 P158I with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTags2xHAExpressionMammalianMutationP158IPromoterCMVAvailable SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV/TO-miR-30 L5-L2
Plasmid#62123PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a tet-inducible CMV promoter and miR30-based hairpin module for shRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseRNAi; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only