We narrowed to 3,563 results for: cmv promoter
-
Plasmid#134338PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA18_Sga with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA18_Sga
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA19_Spse-NLS(SV40) (KAC215)
Plasmid#134339PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA19_Spse with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA19_Spse
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA1-NLS(SV40) (KAC478)
Plasmid#133795PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA1 with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA1
TagsNLS(SV40)ExpressionMammalianMutationn/aPromoterCMV and T7Available SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKG2438_pGEEC534_pShip-CMV-mRuby2-P2A-PuroR-bGH
Plasmid#239730PurposePlasmid expressing mRuby2 and PuroR with the CMV promoterDepositorInsertmRuby2-P2A-PuroR
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJB002 CMV 3xFLAG-NLS-DsDed-ZF1
Plasmid#161532PurposeConstitutive expression ofCMV 3xFLAG-NLS-DsDed-ZF1 under the CMV promoterDepositorInsert3xFLAG-NLS-DsDed-ZF1
UseSynthetic BiologyTags3x-FLAGExpressionMammalianPromoterCMVAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 Y74E-WPRE
Plasmid#250385PurposeLentiviral expression of human NUDT5 Y74E with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 P158T-WPRE
Plasmid#250383PurposeLentiviral expression of human NUDT5 P158T with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTags2xHAExpressionMammalianMutationP158TPromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 P66L-WPRE
Plasmid#250378PurposeLentiviral expression of human NUDT5 P66L with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 G150V-WPRE
Plasmid#250381PurposeLentiviral expression of human NUDT5 G150V with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTags2xHAExpressionMammalianMutationG150VPromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 C76Y-WPRE
Plasmid#250379PurposeLentiviral expression of human NUDT5 C76Y with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 K175M-WPRE
Plasmid#250384PurposeLentiviral expression of human NUDT5 K175M with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTags2xHAExpressionMammalianMutationK175MPromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-tagBFP-NUDT5 E112Q-WPRE
Plasmid#250376PurposeLentiviral expression of human NUDT5 carrying E112Q mutation with N-terminal tagBFP under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTagstagBFPExpressionMammalianMutationE112QPromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 Y74F-WPRE
Plasmid#250380PurposeLentiviral expression of human NUDT5 Y74F with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 P158I-WPRE
Plasmid#250382PurposeLentiviral expression of human NUDT5 P158I with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTags2xHAExpressionMammalianMutationP158IPromoterCMVAvailable SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CMV-Cas9-P2A-HygR
Plasmid#164133PurposeLentiviral construct for the expression of SpCas9 driven by CMV promoter in mammalian cellsDepositorAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-MFSD6-Puro
Plasmid#239953PurposeLentiviral vector to generate MFSD6 stable expressing cell line under CMV promoterDepositorInsertMFSD6
UseLentiviralTagsmyc-flagExpressionMammalianAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CMV-V5-RFP-LATS1
Plasmid#235689PurposeExpress RFP tagged LATS1 gene in mammalian cells using the CMV promoterDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CMV-PTPN14-CFP
Plasmid#235686PurposeExpress CFP tagged PTPN14 gene in mammalian cells using the CMV promoterDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMV Puro DEST p38KTRmCerulean3
Plasmid#59155PurposeLentiviral vector to express p38 KTR mCerulean3 under CMV promoter (With Puromycin Resistance)DepositorInsertp38 Kinase Translocation Reporter (MAPK14 Human, Mouse)
UseLentiviralTagsmCerulean3ExpressionMammalianPromoterCMVAvailable SinceSept. 19, 2014AvailabilityAcademic Institutions and Nonprofits only