We narrowed to 3,345 results for: cmv promoter
-
Plasmid#134337PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA16_Efa with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA16_Efa
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
EK0379 CMV-TO-EGFP-stop-t70587 (PB)
Plasmid#191154PurposeExpression of Trigger 1 in the 3' UTR of EGFP in mammalian cells; used to make a cell line to study sensors for integrated 3' UTR or CDS triggers; expression is inducible with doxycycline due to CMV-TO promoter.DepositorInsertEGFP-t70587
ExpressionMammalianMutationWTPromoterCMV-TOAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA16_Lmo-NLS(SV40) (KAC508)
Plasmid#134332PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA16_Lmo with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA16_Lmo
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIC1-NLS(SV40) (KAC208)
Plasmid#134340PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIC1 with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIC1
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA17_Efa-NLS(SV40) (KAC91)
Plasmid#134333PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA17_Efa with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA17_Efa
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA17_Sga-NLS(SV40) (KAC92)
Plasmid#134334PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA17_Sga with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA17_Sga
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA18_Sma-NLS(SV40) (KAC95)
Plasmid#134335PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA18_Sma with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA18_Sma
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA19_Ssim-NLS(SV40) (KAC97)
Plasmid#134336PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA19_Ssim with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA19_Ssim
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA18_Sga-NLS(SV40) (KAC214)
Plasmid#134338PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA18_Sga with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA18_Sga
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA19_Spse-NLS(SV40) (KAC215)
Plasmid#134339PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA19_Spse with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA19_Spse
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA1-NLS(SV40) (KAC478)
Plasmid#133795PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA1 with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA1
TagsNLS(SV40)ExpressionMammalianMutationn/aPromoterCMV and T7Available SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKG2438_pGEEC534_pShip-CMV-mRuby2-P2A-PuroR-bGH
Plasmid#239730PurposePlasmid expressing mRuby2 and PuroR with the CMV promoterDepositorInsertmRuby2-P2A-PuroR
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJB002 CMV 3xFLAG-NLS-DsDed-ZF1
Plasmid#161532PurposeConstitutive expression ofCMV 3xFLAG-NLS-DsDed-ZF1 under the CMV promoterDepositorInsert3xFLAG-NLS-DsDed-ZF1
UseSynthetic BiologyTags3x-FLAGExpressionMammalianPromoterCMVAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-MFSD6-Puro
Plasmid#239953PurposeLentiviral vector to generate MFSD6 stable expressing cell line under CMV promoterDepositorInsertMFSD6
UseLentiviralTagsmyc-flagExpressionMammalianAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-MFSD8-Puro
Plasmid#239954PurposeLentiviral vector to generate MFSD8 stable expressing cell line under CMV promoterDepositorInsertMFSD8
UseLentiviralTagsmyc-flagExpressionMammalianAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-IgK-pHluorin-TM-mRuby
Plasmid#185546PurposeExpresses surface-localized pHluorin fused to intracellular expression of mRuby under CMV promoterDepositorInsertIgK-pHluorin-TM-mRuby
ExpressionMammalianPromoterCMVAvailable SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMV Puro DEST p38KTRmCerulean3
Plasmid#59155PurposeLentiviral vector to express p38 KTR mCerulean3 under CMV promoter (With Puromycin Resistance)DepositorInsertp38 Kinase Translocation Reporter (MAPK14 Human, Mouse)
UseLentiviralTagsmCerulean3ExpressionMammalianPromoterCMVAvailable SinceSept. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CMV-Cas9-P2A-HygR
Plasmid#164133PurposeLentiviral construct for the expression of SpCas9 driven by CMV promoter in mammalian cellsDepositorAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV superYFP-AURKA-mTurq2
Plasmid#157772PurposeExpression of AuroraA kinase biosensor under CMV promoterDepositorAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only