We narrowed to 17,948 results for: erg
-
Plasmid#214889PurposeExpresses the optogenetic tool BiPOLES in cholinergic neurons of C. elegans.DepositorInsertGtACR2_mCerulean_bHK_Chrimson
TagsmCeruleanExpressionWormAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAB17 (punc-17::QuasAr)
Plasmid#214888PurposeExpresses the voltage sensor QuasAr2 in cholinergic neurons of C. elegans.DepositorInsertQuasAr2
ExpressionWormAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAB31 (punc-47::GtACR2::mCerulean::bHK::Chrimson)
Plasmid#214891PurposeExpresses the optogenetic tool BiPOLES in GABAergic neurons of C. elegans.DepositorInsertGtACR2_mCerulean_bHK_Chrimson
TagsmCeruleanAvailable SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetO-Chim-Pchi-Q61A
Plasmid#231520PurposeExpresses Pigoraptor chileana chimeric Sox mutant in mammalian cells, for lentivirus generationDepositorInsertPchi HMG Q61A flanked with N- and C-termini of mSox2
UseLentiviralMutationPoint mutation at position 61 Q to A of the HMG d…Available SinceMarch 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetO-Chim-Pchi-Q61A/E64M
Plasmid#231521PurposeExpresses Pigoraptor chileana chimeric Sox mutant in mammalian cells, for lentivirus generationDepositorInsertPchi HMG Q61A/E64M flanked with N- and C-termini of mSox2
UseLentiviralMutationPoint mutations at position 61 Q to A and 64 E to…Available SinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCOA-Leu-FvPPT1
Plasmid#179923PurposeExpression vector for heterologous expression of a polyketide synthase in S. cerevisiae. Carries and empty insertion site and the Fusarium verticillioides 4´-phosphopantetheinyltransferase PPT1DepositorInsertFvPPT1
ExpressionYeastMutationCodon optimized for expression in Saccharomyces c…PromoterYarrowia lipolytica EXP1Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGTVL2-BIRC2-BIR3
Plasmid#196367Purposeprotein expression of the GST-tagged BIR3 domainDepositorInsertBIRC2 BIR3 domain
TagsHis6-GST-TEVExpressionBacterialMutationcontains only S260-Y352PromoterT7Available SinceFeb. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
TTR C10S E63C
Plasmid#190009PurposeExpression of human TTR in E coliDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
mEos2-dVHH[GFP] in pCSDEST
Plasmid#162870PurposeSuper-resolution of GFP in cultureDepositorInsertmEos2-dVHH[EGFP]
TagsmEos2ExpressionMammalianAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
hHSF1 S307A
Plasmid#118364PurposeThis plasmid expresses human HSF1 S307A mutant.DepositorAvailable SinceNov. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
LV-pCMV-FLPo-pGK-mCl-GP33/66
Plasmid#216481PurposeExpresses FLPo and mClover3 fluorescent protein with LMCV GP33-43 and GP66-77 epitopes embedded in loop of mclover to initiate immunogenic tumor cells in KPFrt miceDepositorInsertsFLPo Recombinase
mClover3-GP33/66
UseLentiviralPromoterpCMV and pGKAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFC902
Plasmid#106904PurposeThe vector has a U3 promoter and terminator controlled gene encoding a transcript containing the sgRNA flanked by a tRNA-Gly repeat; and a gene encoding cas9 controlled by Ptef1 and Ttef1DepositorInsertscas9
pyrG
U3 promoter and terminator controlled gene encoding a transcript containing the sgRNA flanked by a tRNA gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-tetO-Eomes
Plasmid#70271PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine EomesDepositorInsertEomes (Eomes Mouse)
PromotertetOAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4-dTom
Plasmid#178718PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of dTom in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertdTom
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti6/V5-DEST-SPAG5
Plasmid#31217DepositorInsertSPAG5 (SPAG5 Human)
UseLentiviralExpressionMammalianMutationContains a one nucleotide deletion at C-term that…Available SinceAug. 19, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-sh-hSOX9-1
Plasmid#40644DepositorAvailable SinceSept. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti6/V5-DEST-HSF1
Plasmid#31210DepositorAvailable SinceJuly 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS1-hChR2-tBFP
Plasmid#178706PurposeAAV vector for transgene expression of hChR2-tBFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInserthChR2-tBFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti.CMV/TO_PRKAA2
Plasmid#74447PurposeLentiviral expression vector encoding untagged WT human AMPK alpha 2DepositorAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only