We narrowed to 25,900 results for: Nov
-
Plasmid#176068PurposeEGFP fused to the C-terminus of an OB domain & a hygromycin resistance cassetteDepositorInsertOB
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV_iRFP_P2AT2A_mScarlet-I_Myl9
Plasmid#172474PurposeMammalian expression of myosin light chain (Myl9) tagged with mScarlet-I and cytoplasmic iRFP as a reference marker.DepositorInsertsUseLentiviralTagsmScarlet-IExpressionMammalianPromoterEF1alpha (with UCOE) and none (same transcript as…Available SinceSept. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-FH-Nsp16
Plasmid#157724Purposemammalian expression of N-terminally Flag-His8 tagged SARS-CoV-2 Nsp16 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJEP304-pAAV-EFS-dSaCas9-VP64-pA
Plasmid#113679PurposeA EFS driven de-catalyzed SaCas9 fused to VP64 domain for increased transcription in targeted regionDepositorInsertde-catalyzed SaCas9
UseAAV, CRISPR, and Synthetic BiologyTagsNLS and VP64Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Chicken Mermaid S188
Plasmid#53617PurposeGenetically encoded voltage sensor based on mUKG-mKOk FRET pairDepositorInsertChicken Mermaid S188
ExpressionMammalianMutationGg-VSP contains an R153Q mutation and an amino ac…PromoterCMVAvailable SinceAug. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
PCMV-intron myc Rab11 S25N
Plasmid#46786Purposeexpression of S25N Rab11a in mammalian cellsDepositorInsertRAB11A S25N (RAB11A Human)
TagsmycExpressionMammalianMutationS25N dominant negativePromoterCMVAvailable SinceNov. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHR-BRD4ΔN-miRFP670-Cry2WT
Plasmid#122439PurposeExpresses disordered protein BRD4(462-1362) fused with fluorescent protein miRFP670 and optogenetic protein Cry2WTDepositorInsertBRD4 (BRD4 Human)
UseLentiviralTagsCry2WT and miRFP670ExpressionMammalianMutationDeleted amino acids 1-461PromoterSFFVAvailable SinceApril 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFPN1-N-gamma-tubulin (334-449)
Plasmid#87859PurposeFluorescent fragment of gamma-tubulin containing gamma-tubulin DNA binding domain and NLSDepositorInsertgamma-tubulin 1 (TUBG1 Human)
TagsGFPExpressionMammalianMutationfragment from aa 334 to 449Available SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBW_0065
Plasmid#102817PurposepVec8 containing Sr22 geneDepositorAvailable SinceFeb. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac-FLAG-mProser1-IRES-Blast
Plasmid#226172PurposeExpresses full length mouse PROSER1 with 2X N-terminal FLAG tagsDepositorAvailable SinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHMP2A-NS3-blue
Plasmid#223532PurposeMammalian expression of CHMP2A fused to the hepatitis C virus protease NS3 through a short linker containing the NS3 cleavage site, along with a blue fluorescent protein.DepositorInsertCHMP2A (CHMP2A Human)
TagsNS3 Hepatitis C protease and mTurquoiseExpressionMammalianPromoterCMVAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHMP2A-NS3-Green
Plasmid#223440PurposeMammalian expression of CHMP2A fused to the hepatitis C virus protease NS3 through a short linker containing the NS3 cleavage site, along with a green fluorescent protein.DepositorInsertCHMP2A (CHMP2A Human)
TagsNS3 Hepatitis C protease and mNeonGreenExpressionMammalianPromoterCMVAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
MiniCoopR mitfa:KIT L576P
Plasmid#118848PurposeExpresses human KIT L576P mutant and zebrafish mitfa specifically in zebrafish melanocytesDepositorAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFrt-invCAG-ires-Luc
Plasmid#63576PurposeShuttle vector compatible with Flp-mediated (Flp-in) transgene integration that allows for conditional cDNA and Luc expression upon integration. The vector contains an FRT site and two mut loxP sites.DepositorInsertStop-Lox71-IRES-Luciferase-pA-FRT-Lox66-reverseCAG
UseCre/Lox; Frt/flpe recombination mediated insertionExpressionMammalianPromoterCAGAvailable SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC deltaLZ_P2A_Hygro_Barcode
Plasmid#120509PurposeBarcoded lentiviral vector to express MYC deltaLZ in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC deltaLZ (MYC Human)
UseLentiviralMutationDeletion of leucine zipper motifPromoterEF1aAvailable SinceFeb. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC deltaHLH_P2A_Hygro_Barcode
Plasmid#120508PurposeBarcoded lentiviral vector to express MYC deltaHLH in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC deltaHLH (MYC Human)
UseLentiviralMutationDeletion of helix-loop-helix motifPromoterEF1aAvailable SinceFeb. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
HR-TERT-SV40-GFP
Plasmid#71397PurposeHomologues recombination donor plasmid fo the TERT promotor region introducing a SV-40 driven GFP marker in the TERT promotor. Includes 1kb of TERT coding region in right homologues arm.DepositorInsertTERT (TERT Human)
TagsSV-40 GFP insertion in TERT promotorPromoterEndogenous TERT promotorAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAG668 lifeAct-pFAST
Plasmid#172866PurposeExpresses LifeAct-pFAST in mammalian cells (actin labeling)DepositorInsertLifeAct-pFAST
TagsMyc tag (C terminal on insert)ExpressionMammalianPromoterCMVAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only