We narrowed to 27,740 results for: STI
-
Plasmid#115252PurposeFor mammalian expression of the human NODAL open reading frame (with two mutated N-glycosylation sites) with a C-terminal MYC-DYK tagDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only
-
NODAL-MYC-DYK-C312A
Plasmid#115253PurposeFor mammalian expression of the human NODAL open reading frame (with a mutated Cysteine residue) with a C-terminal MYC-DYK tagDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODALvar-MYC-DYK-C302S
Plasmid#115254PurposeFor mammalian expression of a human NODAL splice variant open reading frame (with a mutated Cysteine residue) with a C-terminal MYC-DYK tagDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODALvar-MYC-DYK-C302A
Plasmid#115255PurposeFor mammalian expression of a human NODAL splice variant open reading frame (with a mutated Cysteine residue) with a C-terminal MYC-DYK tagDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODALvar-MYC-DYK-N328A
Plasmid#115246PurposeFor mammalian expression of a human NODAL splice variant open reading frame (with a mutated N-glycosylation site) with a C-terminal MYC-DYK tagDepositorInsertNODAL splice variant (NODAL Human)
TagsMYC-DYKExpressionMammalianMutationN328APromoterCMVAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
PDEST-pSP172BSSPE-pFOGc::RfA-HA
Plasmid#186406PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter HA tag under control of the pFOG ectodermal regulatory sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0033
Plasmid#185624PurposeLevel 0 promoter from N. benthamiana used for sgRNA expression, nonstandard overlaps, GGAG-CTCGDepositorInsertNbU6-2
UseCRISPR and Synthetic BiologyAvailable SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0032
Plasmid#185623PurposeLevel 0 promoter from N. benthamiana used for sgRNA expression, nonstandard overlaps, GGAG-TTCGDepositorInsertNbU6-1
UseCRISPR and Synthetic BiologyAvailable SinceAug. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB106
Plasmid#185065PurposeBacterial expression of C-terminus of NUP1 nucleoporin as GST-Nup1-C fusion including C-terminal half of Nup1 C-terminal FG domainDepositorInsertNUP1
TagsGSTExpressionBacterialMutationNup1 C-terminal region, truncated so C-terminal h…Available SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
FAK C-term
Plasmid#186147PurposeFor expresseion of recombinant FAK c-terminal domain in E. coliDepositorAvailable SinceJune 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2402-Tier1-PhCMV-BlastR
Plasmid#169494PurposeTier-1 vector encoding PhCMV-driven blasticidin resistance gene BlastR (PhCMV-BlastR-pA).DepositorInsertPCMV-driven blasticidin-S deaminase
ExpressionMammalianPromoterPhCMVAvailable SinceJune 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC-9-35S-11
Plasmid#176881PurposeMoClo Level 0 plasmid, contains 35SDepositorInsert35S terminator
ExpressionPlantMutationWTAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NpM-NcPAN2_1-390_Y
Plasmid#148103PurposeBacterial Expression of NcPAN2_1-390DepositorInsertNcPAN2_1-390
ExpressionBacterialAvailable SinceMarch 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCm N-term SMT3 NikJC199U
Plasmid#174210PurposeExpression plasmid with a TEV removable C-term 8xHis Tag, an N-term SUMO tag and Chloramphenicol resistance. NikJ C199U cloned in the cloning site.DepositorInsertnikJ, nikkomycin biosynthesis protein P1 [Streptomyces tendae]
Tags8xHis, SMT3, and TEVExpressionBacterialMutationC199UPromoterT7Available SinceDec. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCm C-term SMT3 NikJC199U
Plasmid#174362PurposeExpression plasmid with a TEV removable C-term 8xHis Tagged SUMO tag, and Chloramphenicol resistance. NikJ C199U cloned in the cloning site.DepositorInsertnikJ, nikkomycin biosynthesis protein P1 [Streptomyces tendae]
Tags8xHis, SMT3, and TEVExpressionBacterialMutationC199UPromoterT7Available SinceDec. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCm N-term MBP NikJC199U
Plasmid#174364PurposeExpression plasmid with a TEV removable N-term MBP tag, a TEV removable C-term 8xHis tag, and Chloramphenicol resistance. NikJ C199U cloned in the cloning site.DepositorInsertnikJ, nikkomycin biosynthesis protein P1 [Streptomyces tendae]
Tags8xHis, MBP, and TEVExpressionBacterialPromoterT7Available SinceDec. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0058
Plasmid#177022PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInsertgeraniol 8-oxidase; geraniol-10-hydroxylase; CYP76B6
UseSynthetic BiologyAvailable SinceDec. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lentiguide-Blast-eNMU710
Plasmid#172658PurposeExpressing paired pegRNAs from human U6 and H1 promoters to make 710-bp deletion on e-NMU locusDepositorInsertpegRNA-eNMUA/pegRNA-eNMUB
UseCRISPRAvailable SinceDec. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0905
Plasmid#177068PurposeMoClo Level 1, position 1, transcriptional unit for transient expression of gal4AD-phiC31 driven by 35S promoterDepositorInsertgal4AD-phiC31
UseSynthetic BiologyAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only