We narrowed to 14,951 results for: RING;
-
Plasmid#127244PurposeHigh photocurrent, low-light sensitive channelrhodopsin (ChRger1) for optogenetic activation with systemic delivery or for low-light activation. Driven by the CamKIIa promoter.DepositorInsertChRger1-TS-EYFP
UseAAVTagsEYFP and SpyTagExpressionMammalianPromoterCamKIIaAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNB784
Plasmid#60163PurposeFirefly luciferase (Promega) yeast codon-optimized yellow fluorescent protein (yEVenus) fusion driven by SIC1 promoter.DepositorInsertFLuc-yEVenus
ExpressionYeastMutationFLuc has A4V & S504G (no functional effect)PromoterSIC1prAvailable SinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJEC626
Plasmid#174367PurposeActivation domain for modular CRISPRa. AD-SYNZIP. Expresses alphaNTD from the E coli RNAP with a SYNZIP17 domain fused to the N terminus.DepositorInsertAlpha N-terminal domain from the E. coli RNA polymerase fused to SYNZIP17
UseSynthetic BiologyExpressionBacterialPromoterJ23106Available SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_m4_EYFP
Plasmid#167866PurposePiggyBac compatible plasmid expressing dCas9DepositorInsertdCas9
UseCRISPRMutationD10A, D839A, H840A, N863AAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBlueScript II SK-SNAP donor for H3f3b
Plasmid#186933PurposeGenomic targeting of SNAP tag at H3f3b C-terminalDepositorAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 EB1 shRNA #1
Plasmid#37928DepositorAvailable SinceJuly 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pIhh1.3K-Luc
Plasmid#53604PurposeReporter construct containing a 1.3 kb promoter region of the Ihh gene in front of a luciferase gene for in vitro DNA transfection assaysDepositorInsertIhh promoter
UseLuciferase; ReporterAvailable SinceJune 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRS406 ATG1-ATG17-3'UTR
Plasmid#166848PurposeExpresses Atg1 with ATG17 3'UTR in yeasts.DepositorAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
mr in pUASP
Plasmid#112981PurposeP element vector for transposon insertion of mr (APC2) into Drosophila genomeDepositorInsertmr (APC2) (mr Fly)
UseP insertion vectorAvailable SinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAtCas9-H840A_1
Plasmid#91162PurposeCas9 only expression, Cas9 Type: AtCas9_H840A (nickase), Plant Selection: 2x35S:hpt IIDepositorInsertAtCas9_H840A (nickase)
UseCRISPRExpressionPlantMutationH840AAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPPC027.306
Plasmid#171149PurposeBiopterin production pathway with J306 scRNA on pBBR1-GmR plasmidDepositorInsertsJ306 scRNA
J3-BBa_J23117-GTPCH_J3-BBa_J23117-PTPS_J3-BBa_J23117-SR
UseCRISPRExpressionBacterialPromoterBBa_J23119 and J3-BBa_J23117Available SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pTaCas9-H840A_6
Plasmid#91173PurposeCas9 only expression, Cas9 Type: TaCas9_H840A (nickase), Plant Selection: PvUbi2:barDepositorInsertTaCas9_H840A (nickase)
UseCRISPRExpressionPlantMutationH840AAvailable SinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
POT11-RFP
Plasmid#65327Purposereceiving vector of standard transcription units(TUs) in YeastFab work, useful for further assemblyDepositorInsertRFP
UseSynthetic BiologyAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRS424-URR
Plasmid#65330Purposehigh copy number plasmid as receiving vector for exogenous pathwayDepositorInsertURR1-RFP-Leu2-URR2
UseSynthetic BiologyAvailable SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
POT5-RFP
Plasmid#65321Purposereceiving vector of standard transcription units(TUs) in YeastFab work, useful for further assemblyDepositorInsertRFP
UseSynthetic BiologyAvailable SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRS414-URR
Plasmid#65329PurposeCEN plasmid as receiving vector for exogenous pathwayDepositorInsertURR1-RFP-Leu2-URR2
UseSynthetic BiologyAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
POT3-RFP
Plasmid#65319Purposereceiving vector of standard transcription units(TUs) in YeastFab work, useful for further assemblyDepositorInsertRFP
UseSynthetic BiologyAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
POT9-RFP
Plasmid#65325Purposereceiving vector of standard transcription units(TUs) in YeastFab work, useful for further assemblyDepositorInsertRFP
UseSynthetic BiologyAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only