We narrowed to 2,923 results for: COB;
-
Plasmid#205944PurposeExpress mEGFP-tagged fusion protein, TMPRSS2_ETV1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only
-
CL20_mEGFP_NUP98_NSD1
Plasmid#205873PurposeExpress mEGFP-tagged fusion protein, NUP98_NSD1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDNA2.0-6H-TEV-KRAS G12D
Plasmid#159439PurposeExpresses KRAS G12D in E.coliDepositorAvailable SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_NUP98_HOXD13
Plasmid#205871PurposeExpress mEGFP-tagged fusion protein, NUP98_HOXD13 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_BCL9L_CBL
Plasmid#205779PurposeExpress mEGFP-tagged fusion protein, BCL9L_CBL from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_TMPRSS2_ERG
Plasmid#205943PurposeExpress mEGFP-tagged fusion protein, TMPRSS2_ERG from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_38
Plasmid#60279PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_ARID1B_ZNF384
Plasmid#205772PurposeExpress mEGFP-tagged fusion protein, ARID1B_ZNF384 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_EML4_BRAF
Plasmid#205812PurposeExpress mEGFP-tagged fusion protein, EML4_BRAF from patient-derived sequenceDepositorAvailable SinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_ASCC3_GRIK2
Plasmid#205774PurposeExpress mEGFP-tagged fusion protein, ASCC3_GRIK2 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_CREBBP_ZNF384
Plasmid#205796PurposeExpress mEGFP-tagged fusion protein, CREBBP_ZNF384 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_33
Plasmid#60275PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_COL3A1_CLU
Plasmid#205794PurposeExpress mEGFP-tagged fusion protein, COL3A1_CLU from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_AIMP2_EIF2AK1
Plasmid#205770PurposeExpress mEGFP-tagged fusion protein, AIMP2_EIF2AK1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_13
Plasmid#60298PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertEDN3 enhancer (EDN3 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_CCDC6_ANK3
Plasmid#205788PurposeExpress mEGFP-tagged fusion protein, CCDC6_ANK3 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_20
Plasmid#60303PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertCDKN1C enhancer (CDKN1C Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
KRAS-A146T
Plasmid#154426PurposeA146T Kras with Flag tag inserted into N-terminal domain between 6Xhis tag and TEV cleavage site.DepositorInsertKRAS (KRAS Human)
UseTags6xHis-tag and TEV protease cleavage sequenceExpressionBacterialMutationPromoterT5Available SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C5_15
Plasmid#60322PurposeThis plasmid contains a genomic fragment that is not active in human pancreatic islets, a minimal promoter and a luc2 gene. Can be used as negative control in reporter assays performed in human pancreatic islets.DepositorInsertNon active element (nearest TSS PHLDA1) (PHLDA1 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_33
Plasmid#60312PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertGLIS3 enhancer (GLIS3 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
UseTagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_RUNX1_CBFA2T3
Plasmid#205914PurposeExpress mEGFP-tagged fusion protein, RUNX1_CBFA2T3 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_KPNA1_GMPS
Plasmid#205844PurposeExpress mEGFP-tagged fusion protein, KPNA1_GMPS from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_LCLAT1_GREB10
Plasmid#205845PurposeExpress mEGFP-tagged fusion protein, LCLAT1_GREB1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_LMX1B_GTF3C5
Plasmid#205847PurposeExpress mEGFP-tagged fusion protein, LMX1B_GTF3C5 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_MBNL1_MEIS2
Plasmid#205848PurposeExpress mEGFP-tagged fusion protein, MBNL1_MEIS2 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_MEX3D_DCTN6
Plasmid#205855PurposeExpress mEGFP-tagged fusion protein, MEX3D_DCTN6 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_MFF_ERBB4
Plasmid#205856PurposeExpress mEGFP-tagged fusion protein, MFF_ERBB4 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_KMT2A_EPS15
Plasmid#205841PurposeExpress mEGFP-tagged fusion protein, KMT2A_EPS15 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_ETV6_ABL1
Plasmid#205814PurposeExpress mEGFP-tagged fusion protein, ETV6_ABL1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_CREBBP_ATG10
Plasmid#205795PurposeExpress mEGFP-tagged fusion protein, CREBBP_ATG10 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_ASCC1_MICU1
Plasmid#205773PurposeExpress mEGFP-tagged fusion protein, ASCC1_MICU1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_ASPSCR1_METRNL
Plasmid#205775PurposeExpress mEGFP-tagged fusion protein, ASPSCR1_METRNL from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_27
Plasmid#60307PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertC16orf80 enhancer (CFAP20 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_28
Plasmid#60308PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertCRY2 enhancer (CRY2 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_32
Plasmid#60311PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertDGKB enhancer (DGKB Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_36
Plasmid#60314PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertDNMT3A enhancer (DNMT3A Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_37
Plasmid#60315PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertARHGAP26 enhancer (ARHGAP26 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_38
Plasmid#60316PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertACSL1 enhancer (ACSL1 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_39
Plasmid#60317PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertPCSK1 enhancer (PCSK1 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_6
Plasmid#60255PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_8
Plasmid#60257PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_11
Plasmid#60260PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_13
Plasmid#60261PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_20
Plasmid#60266PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_27
Plasmid#60270PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_28
Plasmid#60271PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_32
Plasmid#60274PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_36
Plasmid#60277PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_37
Plasmid#60278PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only