We narrowed to 43,204 results for: tro
-
Plasmid#236231PurposeAAV expression of a fluorescent marker, mTagBFP2, fused to the plasma membrane targeting sequence CAAX2DepositorInsertmTagBFP2 fused to the plasma membrane targeting sequence CAAX2
UseAAVTagsmTagBFP2Promoterhuman Synapsin 1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mCherry-Jph3 WPRE
Plasmid#236237PurposeAAV expression of human Junctophilin3 N-terminally tagged with mCherryDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mScarlet-CAAX2 WPRE
Plasmid#236232PurposeAAV expression of a fluorescent marker, mScarletI, fused to the plasma membrane targeting sequence CAAX2DepositorInsertmScarletI fused to the plasma membrane targeting sequence CAAX2
UseAAVTagsmScarletIPromoterhuman Synapsin 1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-aSYNUCLEIN A53T
Plasmid#227004PurposeAAV transfer plasmid encoding the human A53T mutant α-SYN under the control of the CMVie enhanced synapsin1 promoterDepositorInsertalpha synuclein A53T mutant (SNCA Synthetic, Human)
UseAAVMutationA53TPromoterCMVenh synapsinAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-mScarlet-Frame1-Parental-Minicircle
Plasmid#216125PurposeParental minicircle containing mScarlet-I flanked by a splice acceptor and splice donor. Used with other intron tagging plasmids for placing the mScarlet tag as a synthetic exon into frame 1 introns of target genes.DepositorInsertsgRNA-SA-(GGGGS)x4-mScarlet-I-(GGGGS)x4-SD
UseCRISPRAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
CycK-GFP (1-270AA) in Cilantro (Codon optimized)
Plasmid#169930PurposeOverexpression of 1-270AA CycK-GFP fusionDepositorAvailable SinceJuly 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-P(Cry1)-DIO-intron336-Venus-NLS-D2
Plasmid#110055PurposeCry1 transcription fluorescence reporterDepositorInsertCry1 promoter and Venus (Cry1 Mouse)
UseAAV and Cre/LoxTagsNLS-D2ExpressionMammalianPromoterCry1Available SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-Trono-EFS-Blast-P2A-TurboRFP
Plasmid#228893PurposeCloning and expression of gRNAs or pegRNAs with EcoRI/Esp3I insertion.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Pzac2.1 U6-control sgRNA1, 2, 3_gfaABC1D mcherry SV40
Plasmid#179120PurposeExpresses control sgRNAs under the U6 promoter and mcherry protein specifically in astrocytesDepositorInsertcontrol sgRNA
UseAAVPromoterU6Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-TRE3G-IRSp53-T2A-Cdc42(G12V)
Plasmid#221329PurposeDox-inducible expression of FLAG-IRSp53-T2A-HA-Cdc42 G12V in mammalian cells by retroviral transductionDepositorUseRetroviralMutationG12VPromoterTRE3GAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-TRE3G-IRSp53-T2A-Rac1(G12V)
Plasmid#221330PurposeDox-inducible expression of FLAG-IRSp53-T2A-HA-Rac1 G12V in mammalian cells by retroviral transductionDepositorUseRetroviralMutationG12VPromoterTRE3GAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-P(Per2)-DIO-intron2-Venus-NLS-D2
Plasmid#110057PurposePer2 transcription fluorescence reporterDepositorInsertPer2 promoter and Venus (Per2 Mouse)
UseAAV and Cre/LoxTagsNLS-D2ExpressionMammalianPromoterPer2Available SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVitro2-hygro-N-myc-hVps34/hVps15-C-V5-his
Plasmid#24055DepositorUseBicistronicTagsMyc (hVps34) and V5/his (hVps15)ExpressionMammalianAvailable SinceJune 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
mCherry-pCAG-donor(R2Tg)-GFP(intron)
Plasmid#223248PurposeMammalian expression of the R2Tg RNA donorDepositorInsertR2Tg donor
ExpressionMammalianAvailable SinceAug. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mEmerald-STIM1 WPRE
Plasmid#236234PurposeAAV expression of mouse STIM1 internally tagged with mEmeraldDepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
SVA-lncRNA AK057321 shRNA 1A scramble control
Plasmid#202835PurposeLentiviral vector that expresses a scrambled control shRNA for SVA-lncRNA AK057321 shRNA 1ADepositorInsertpLVX-SVA-lncRNA shRNA 1A scramble control
UseLentiviralExpressionMammalianPromoterU6Available SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-Positron2-ST-WPRE
Plasmid#239080PurposeAAV-mediated expression of positive-going voltage sensor under the Syn promoter, Cre-dependent expression; soma localization targeting sequenceDepositorInsertPositron2-ST
UseAAV and Cre/LoxTagssoma localization targeting sequenceExpressionMammalianMutationR78K N81D D92N W178FPromoterhSynapsin1Available SinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
PP_071_pAAV_CAG_DIO-LR-Voltron2-P2A-LR-CheRiff-TS-eYFP-ER2
Plasmid#203229PurposeCre-dependent version of PP_070. Co-expressing membrane-localized Voltron2 and membrane-localized CheRiff.DepositorInsertCre-dependent, membrane-localized Optopatch
UseAAVExpressionMammalianPromoterCAGAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-EGFP-Frame0-Parental-Minicircle
Plasmid#216124PurposeParental minicircle containing EGFP flanked by a splice acceptor and splice donor. Used with other intron tagging plasmids for placing the EGFP tag as a synthetic exon into frame 0 introns of target genes.DepositorInsertsgRNA-SA-(GGGGS)x4-EGFP-(GGGGS)x4-SD
UseCRISPRAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only