We narrowed to 13,356 results for: ache
-
Plasmid#221385PurposeLentiviral expression of SpCas9-6xNLS(c-Myc) with puromycin resistance geneDepositorInsertSpCas9
UseCRISPR and LentiviralTagsFLAGExpressionMammalianAvailable SinceJune 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKK-mCherry-TEV
Plasmid#105779PurposeExpression of your protein of interest in fusion with red fluorescent protein at the N-terminus (cleavable by TEV), (PMID: 15558047). mCherry descends from the first truly monomeric red FP mRFP1.DepositorTypeEmpty backboneUseFlp-in competentTagsmCherry-TEVExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcsII-pb2-flag
Plasmid#86766PurposeC-terminal flag-tagged protein expression in mammalian cells, lentiviral vectorDepositorInsertproteasome beta subunit 2 (PSMB2 Human)
UseLentiviralTagsflagExpressionMammalianPromoterEF-1aAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapsin.SF-Venus-iGluSnFR.A184V
Plasmid#106178PurposeMedium affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-Venus-iGluSnFR.A184V
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: A184VPromoterhSynapsinAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pNL-CEF-CD79A-YFP
Plasmid#187004PurposeExpression of human CD79A as YFP fusion proteinDepositorAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Nprot-HF_GC3opt
Plasmid#157732Purposemammalian expression of C-terminally His8-Flag tagged SARS-CoV-2 N protein under control of a tetracycline-inducible promoterDepositorInsertNprot-HF_GC3opt (N SARS-CoV-2)
TagsHis8-FlagExpressionMammalianMutationcodon optimized; gene expression was optimized by…Available SinceAug. 10, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG-FLEX.SF-Venus-iGluSnFR.A184S
Plasmid#106189PurposeTight affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-Venus-iGluSnFR.A184S
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: A184SPromoterCAGAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapsin.SF-Venus-iGluSnFR.A184S
Plasmid#106177PurposeTight affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-Venus-iGluSnFR.A184S
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: A184SPromoterhSynapsinAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-3xFLAG-LMNB1
Plasmid#207777PurposeDonor template for Blast-2A-3xFLAG insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-3xFLAG Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTRIP-CMV-mtagBFP2-2A-FLAG-cGAS E225A/D227A
Plasmid#102604PurposeLentivector to express Flag-tagged and catalytically-inactive cGAS and mTagBFPDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLIB_GST-TEV-SRC (Y530F)
Plasmid#223743PurposeExpression of recombinant protein for purificationDepositorInsertSrc Kinase (SRC Human)
TagsGST-TEVExpressionInsectMutationY530F constitutively active mutantAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-Puro-CLTC
Plasmid#227314PurposeDonor template for mStayGold-2A-Puro insertion into the C-terminus of the CLTC locus. For clathrin heavy chain visualization. To be co-transfected with sgRNA px330-PITCh-CLTC (Addgene #227312)DepositorInsertCLTC Homology Arms flanking a mStayGold-2A-Puro Cassette (CLTC Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-PEX3
Plasmid#227304PurposeDonor template for mStayGold insertion into the C-terminus of the PEX3 locus. For peroxisome visualization. To be co-transfected with sgRNA plasmid px330-PITCh-PEX3 (Addgene #227303)DepositorInsertPEX3 Homology Arms flanking a mStayGold Tag (PEX3 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKK-mRuby3-TEV
Plasmid#105780PurposeExpression of your protein of interest in fusion with red fluorescent protein at the N-terminus (cleavable by TEV), (PMID: 26879144). mRuby3 is brighter than mCherry and has shifted ex and em spectra.DepositorTypeEmpty backboneUseFlp-in competentTagsmRuby3-TEVExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSUMO His6 SUMO SnRK2.6 (11-362)
Plasmid#177847PurposeBacterial Expression of SnRK2.6DepositorAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKK-BI16-TEV-mCherry
Plasmid#105800PurposeConcomitant expression of two proteins. One protein is expressed with mCherry fusion tag (at the C-terminus), cleavable by TEV protease; second tag introduced by user.DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-mCherryExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-TEV-mRuby3
Plasmid#105797PurposeExpression of your protein of interest in fusion with red fluorescent protein at the C-terminus (cleavable by TEV) (PMID: 26879144). mRuby3 is brighter than mCherry and has shifted ex and em spectra.DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-mRuby3ExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG_GST-TEV-EGFP-ATG13
Plasmid#223797PurposeExpression of recombinant protein for purificationDepositorAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only