We narrowed to 20,805 results for: ATO
-
Plasmid#174811PurposeBacterial expression of a hyperactive PARP1 CAT lacking the autoinhibitory HD subdomainDepositorInsertPARP1-CATdeltaHD (PARP1 Human)
Tags6xHisExpressionBacterialMutationResidues 678-787 replaced by eight-residue linker…Available SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUb FLAG-Human IntS6
Plasmid#198408PurposeExpresses FLAG-tagged human IntS6DepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-VenusYFP-3AT
Plasmid#71269PurposeEntry clone containing Venus. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertVenusYFP
UseGatewayTags4xGly linker and T3A pea Pisum sativum ribulose-1…Available SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1delZn2delBRCT
Plasmid#173939PurposeBacterial expression of PARP1 lacking Zn2 and BRCT domainsDepositorInsertPARP1delZn2delBRCT (PARP1 Human)
Tags6xHisExpressionBacterialMutationDeletion of residues 97-213 and 374-520; V762AAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
kanMX6-ins2
Plasmid#195039PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertKanR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER-21-LCOR
Plasmid#97038PurposeExpresses LCOR in mammalian cellsDepositorInsertLigand Dependent Nuclear Receptor Corepressor (LCOR Human)
UseLentiviralExpressionMammalianPromoterTet onAvailable SinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
natMX6-ins5
Plasmid#195042PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertNatR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-CAT-L713F
Plasmid#173944PurposeBacterial expression of isolated PARP1 CAT domain containing L713F gain-of-function mutationDepositorAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Tet-O-FUW-STAT4-P2A-mCherry
Plasmid#203853PurposeTet-inducible lentiviral plasmid expressing STAT4-P2A-mCherry, with ORF specific barcode close to 3'LTR siteDepositorInsertSTAT4 (STAT4 Human)
ExpressionMammalianAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRP1MX6-ins4
Plasmid#195041PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertTRP1
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-L713F
Plasmid#174794PurposeBacterial expression of a hyperactive PARP1 mutant (L713F destabilizes the autoinhibitory HD subdomain)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-C125G
Plasmid#174792PurposeBacterial expression of a less active PARP1 mutant (C125G reduces affinity for single-strand DNA break)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDN-T2dMFot
Plasmid#44558DepositorInsertsPTETREG promoter
rtetR-M2::FFF
UseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationCompared to rtTA, rtTA-M2 has S12G, E19G, A56P, D…PromoterPTETREGAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mDrc7-FLAG
Plasmid#176470PurposeExpression vector of mouse dynein regulatory complex subunit 7 (Drc7) tagged with FLAG at C-terminus.DepositorInsertdynein regulatory complex subunit 7 (Drc7 Mouse)
TagsFLAGExpressionMammalianPromoterCAG promoterAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
his3MX6-ins3
Plasmid#195040PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertHis5+
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-Y986H
Plasmid#174801PurposeBacterial expression of a PARP1 mutant that produces highly branched but short PAR chains overallDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-Y986S
Plasmid#174802PurposeBacterial expression of a PARP1 mutant that produces mainly short PAR oligomersDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-G972R
Plasmid#174800PurposeBacterial expression of a PARP1 mutant that produces less PAR oligomers overallDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBT270_(pCA-G-intron(Neo)-tTA2-iiTRE-tdT3Mycii)
Plasmid#36881DepositorInsertsGFP
tTA2
beta-globin intron
Neo
tdT-3Myc
insulator
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
scAAV-TTR-mFgf15
Plasmid#190594PurposeAAV construct containing Fgf15 cds under control of TTR promoterDepositorAvailable SinceFeb. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-A774L
Plasmid#174796PurposeBacterial expression of a hyperactive PARP1 mutant (A774L destabilizes the autoinhibitory HD subdomain)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-W318R
Plasmid#174793PurposeBacterial expression of an inactive PARP1 (W318R disrupts interdomain communication and HD subdomain unfolding)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLex307-UCOE-SFFV-puroR-MCP-MLLx3-HSF1
Plasmid#218558PurposeEncodes SFFV promoter-driven MCP-MLLx3-HSF1 with an N-terminal bipartite SV40 NLS, along with puromycin resistanceDepositorInsertMCP-MLLx3-HSF1
UseLentiviralTagsSV40NLSExpressionMammalianMutationCas9 mutations to make dCas9=D10A+D839A+H840A+N86…Available SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLex307-UCOE-SFFV-puroR-MCP-P65-HSF1
Plasmid#218559PurposeEncodes SFFV promoter-driven MCP-P65-HSF1 with an N-terminal bipartite SV40 NLS, along with puromycin resistanceDepositorInsertMCP-P65-HSF1
UseLentiviralTagsSV40NLSExpressionMammalianMutationCas9 mutations to make dCas9=D10A+D839A+H840A+N86…Available SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1(+)-hSyn-HA-mTREK-1(S131C/A286F)-IRES-GFP
Plasmid#225490PurposeNeuronal expression IRES-containing bicistronic vector for generating mTREK-1 (S131C/A286F) + EGFP under the hSyn promoter.DepositorInsertPotassium channel subfamily K member 2 (Kcnk2 Mouse)
UseNeuronal expressionExpressionMammalianPromoterhSynAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-eGFP:HA-mTREK-1(tandem S131C-S131C)
Plasmid#224779PurposeMammalian expression vector for generating a tandem mTREK-1 with two identical monomers linked through a 20 AA flexible linkerDepositorInsertTandem TREK-1 S131C-S131C) (Kcnk2 Mouse)
ExpressionMammalianMutationS131C / S562CPromoterCMVAvailable SinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE:mTREK-1 (S131C/C159A/C219A/C365A/C399A)
Plasmid#224755PurposeIn vitro transcription for Oocyte expression of mTREK-1 (S131C/C159A/C219A/C365A/C399A)DepositorInsertPotassium channel subfamily K member 2 (Kcnk2 Mouse)
UseIn vitro transcription for oocyte expressionMutationS131C/C159A/C219A/C365A/C399APromoterT7Available SinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE:mTREK-1 (S131A/C159A/C219A/C365A/C399A)
Plasmid#224756PurposeIn vitro transcription for Oocyte expression of mTREK-1 (S131A/C159A/C219A/C365A/C399A)DepositorInsertPotassium channel subfamily K member 2 (Kcnk2 Mouse)
UseIn vitro transcription for oocyte expressionMutationS131A/C159A/C219A/C365A/C399APromoterT7Available SinceSept. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tet-O-FUW-PBX4-P2A-mCherry
Plasmid#203864PurposeTet-inducible lentiviral plasmid expressing PBX4-P2A-mCherry, with ORF specific barcode close to 3'LTR siteDepositorInsertPBX4 (PBX4 Human)
ExpressionMammalianAvailable SinceAug. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQCXIH FRB Ubiqutin-BFP
Plasmid#202426PurposeTagBFP FKBP-rapamycin binding (FRB) dimerization domain fused to ubiquitinDepositorInsertFKBP-rapamycin binding (FRB) dimerization domain
UseLentiviralTagsUbiquitin, TagBFPAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
kanMX6-ins1
Plasmid#195038PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tDEG1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertKanR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mDrc3-PA
Plasmid#176467PurposeExpression vector of mouse dynein regulatory complex subunit 3 (Drc3) tagged with PA at C-terminus.DepositorAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1delZn1-L713F
Plasmid#173937PurposeBacterial expression of PARP1 lacking Zn1 domain but containing L713F gain-of-function mutationDepositorInsertPARP1delZn1-L713F (PARP1 Human)
Tags6xHisExpressionBacterialMutationDeletion of residues 1-96; L713F, V762AAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-G871L
Plasmid#174798PurposeBacterial expression of a hyperactive PARP1 mutant (G871L destabilizes the autoinhibitory HD subdomain)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-A870L
Plasmid#174797PurposeBacterial expression of a hyperactive PARP1 mutant (A870L destabilizes the autoinhibitory HD subdomain)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-K893I
Plasmid#174799PurposeBacterial expression of an inactive mutant (K893I may disrupt NAD+ binding)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
p35S_GFP-EVDinter-GUS
Plasmid#167123PurposePlant binary expression vector containing the intron and proximal polyadenylation signal sequences of the Copia93 retroelement EVADE (AT5G17125) between mGFP5 and GUS under CaMV 35S promoter.DepositorInsertEVADE GAG intron and terminator (EVD_in/ter) (AT5G17125 Mustard Weed)
TagsGUS and mGFP5ExpressionPlantPromoterCaMV 35SAvailable SinceApril 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
DHC1-mIAA17 Hygro
Plasmid#140544PurposeDHC1 tagging with mIAA7DepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
DHC1-AID-Clover donor (Hygro)
Plasmid#158622PurposeDonor plasmid for tagging DHC1 with AID-CloverDepositorInsertDHC1 (DYNC1H1 Human)
UseCRISPR; Tagging donorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP FL
Plasmid#179550Purposeencodes S. pyogenes dCas9 with c-terminal fusion of full length human CBP driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of full length human CBP (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tet-O-FUW-NR4A1-P2A-mCherry
Plasmid#203859PurposeTet-inducible lentiviral plasmid expressing NR4A1-P2A-mCherry, with ORF specific barcode close to 3'LTR siteDepositorInsertNR4A1 (NR4A1 Human)
ExpressionMammalianAvailable SinceAug. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tet-O-FUW-ZEB2-P2A-mCherry
Plasmid#203857PurposeTet-inducible lentiviral plasmid expressing ZEB2-P2A-mCherry, with ORF specific barcode close to 3'LTR siteDepositorInsertZEB2 (ZEB2 Human)
ExpressionMammalianAvailable SinceAug. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
FUW-tetO-wtYAP
Plasmid#84009Purposeexpresses wtYAP in mammalian cells under the control of a doxycycline-inducible promoterDepositorInsertYAP1 (siRNA insensitive) (YAP1 Human)
UseLentiviralTagsFLAGExpressionMammalianPromoterTRE-CMVAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMK297 (DHC1-mAID Hygro)
Plasmid#140542PurposeDHC1 tagging with mAIDDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMK296 (DHC1-mAID Neo)
Plasmid#140541PurposeDHC1 tagging with mAIDDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_SOCS3_WT
Plasmid#82245PurposeGateway Donor vector containing SOCS3 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL delta EC
Plasmid#202423PurposeExpression of GFP-tagged PODXL without extracellular domainDepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL 5N>Q
Plasmid#202419PurposeExpression of GFP-tagged PODXL with mutated N-linked glycosylation sitesDepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER-21-LCOR-P2A-HOXA9-T2A-HOXA5
Plasmid#97044PurposeExpresses LCOR, P2A, HOXA9, T2A and HOXA5 in mammalian cells. *Please see notes below on P2A cleaving efficiency.DepositorInsertLigand Dependent Nuclear Receptor Corepressor, Runt-related transcription factor 1, ETS-related gene
UseLentiviralExpressionMammalianPromoterTet onAvailable SinceSept. 5, 2017AvailabilityAcademic Institutions and Nonprofits only