We narrowed to 9,681 results for: control
-
Plasmid#120450PurposeBarcoded lentiviral vector to express HNF4A in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only
-
NbBCP1b-p3
Plasmid#160002PurposeMultigene construct containing the betalain pigment biosynthetic genes under the control of the NbBCP1b promoter for visualisation of arbuscular mycorrhizal colonisation in Nicotiana benthamiana rootsDepositorInsertsBar (reverse orientation)
DODAα1
CYP76AD1
cDOPA5GT
ExpressionPlantPromoterAgrobacterium tumefaciens Nopaline synthase Promo…Available SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLX307-VHL(C162F)-3F-BirA
Plasmid#220149PurposeExpresses VHL(C162F)-BirA as a control for VHL substrate identification by E-STUBDepositorInsertvon Hippel-Lindau tumor suppressor (VHL Human)
UseLentiviralTags3F-BirAExpressionMammalianMutationchanged cysteine 162 to phenylalanine; codon opti…PromoterEF-1aAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSimpleII-U6-tracr-U6-BsmBI-NLS-NmCas9-HA-NLS(s)
Plasmid#47868PurposeThis plasmid contains expression cassette for NmCas9 with N and C NLS and an HA tag, a cassette for expression of tracrRNA, a cassette for cloning crRNA under the control of U6 promoter.DepositorInsertsNmCas9
U6pr-tracrRNA
UseCRISPRTagsHA and NLSExpressionMammalianPromoterEF1a and U6Available SinceSept. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-MYRIP
Plasmid#89586PurposeExpression plasmid for a positive control prey protein in NanoSPD 2.0 assays.DepositorAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-Tet-on 3G-Puro U6 BbsI
Plasmid#159756PurposePiggybacTransposon-based expression control of Tet-on 3G, Puro and Cas13d U6 gRNA backboneDepositorTypeEmpty backboneUsePiggybac transposonExpressionMammalianPromoterU6Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-dCas9-mD3A
Plasmid#78257PurposeExpresses dead Cas9 (dCas9) fused to inactive DNMT3A catalytic domain (CD) under the control of the CMV promoterDepositorInsertDNMT3A CD aa 598-912 (DNMT3A Human)
UseCRISPRTagsFlag epitope tagExpressionMammalianMutationE756APromoterpCMVAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-GCaMP 6m-p2A-ChRmine-Kv2.1-WPRE
Plasmid#131003Purposebicistronic AAV vector to express GCaMP6m and soma-targeted ChRmine under the control of CamKIIa promoterDepositorInsertChRmine
UseAAVTagsKv2.1-HAPromoterCaMKIIaAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-dCas9-D3A
Plasmid#78256PurposeExpresses dead Cas9 (dCas9) fused to DNMT3A catalytic domain (CD) under the control of the CMV promoterDepositorInsertDNMT3A CD aa 598-912 (DNMT3A Human)
UseCRISPRTagsFlag epitope tagExpressionMammalianPromoterpCMVAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCherryGFP-Inframe-noFSE
Plasmid#177619PurposeDual fluorescent protein reporter for SARS-CoV-2 programmed -1 ribosomal frameshifting. No FSE was inserted. mCherry and GFP are expressed equally (positive control).DepositorInsertNone
UseLentiviralExpressionMammalianAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV.tetO.Nurr1
Plasmid#234848Purpose3rd generation lentiviral vector, expresses Nurr1 under control of TetON promoterDepositorAvailable SinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV.tetO.lmx1a
Plasmid#234847Purpose3rd generation lentiviral vector, expresses Lmx1a under control of TetON promoterDepositorAvailable SinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pN1-CMV-H-sDarken
Plasmid#184800PurposeHigh affinity version of the Serotonin Sensor sDarken under the control of a CMV Promoter.DepositorInsertH-sDarken
ExpressionMammalianPromoterCMVAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-ExRai-AKAR2(T/A)
Plasmid#161754PurposeNegative-control mutant for ExRai-AKAR2 biosensor.DepositorInsertExRai-AKAR2(T/A)
ExpressionMammalianMutationContains Thr-to-Ala mutation in substrate sequenc…PromoterCMVAvailable SinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRmine-mScarlet-Kv2.1-WPRE
Plasmid#130991PurposeAAV vector to drive the expression of soma-targeted ChRmine-mScarlet under the control of CamKIIa promoterDepositorHas ServiceAAV8InsertChRmine
UseAAVTagsmScarlet-Kv2.1PromoterCaMKIIaAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
CAG FLEX BARK D110A p2A mCherry
Plasmid#117694PurposeCAG-FLEx-iBARK(D110A)-p2A-mCherry: Negative control viral expression vector for Cre-dependent Gaq silencingDepositorInsertBARKrgs D110A peptide
UseCre/LoxTagsHA / FLAGMutationD110AAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO hChR2(E123A)-EYFP
Plasmid#35507PurposeAAV expression of EF1a-driven, cre-dependent, hChR2 variant CheTA 2.0 for ultrafast optogenetic control.DepositorInserthChR2
UseAAVTagsEYFPExpressionMammalianMutationE123APromoterEf1aAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGP-CAG-iGABASnFR2(no bind)-WPRE-bGH-polyA
Plasmid#218870PurposeMammalian expression of improved GABA sensor control (no change in fluorescence)DepositorInsertiGABASnFR2(no bind)
ExpressionMammalianMutationS99A F102G R168PPromoterCAGAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBait-YY1
Plasmid#165147PurposeBait plasmid for PROBER with YY1-binding site (positive control)DepositorInsert3X YY1 motif
UseUnspecifiedAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only