We narrowed to 17,306 results for: ESC
-
Plasmid#111144PurposeExpression of mouse Trex2 and BFP reporter in mammalian cellsDepositorExpressionMammalianPromoterCAG and EF1Available SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only
-
cmamxA1-GFP
Plasmid#107195PurposeExpresses porcine annexin A1-GFP fusion protein for live cell imaging, all type II Ca2+ binding sites deletedDepositorInsertcmannexin A1
TagsGreen Fluorescent ProteinExpressionMammalianMutationexchanges Asp170Ala, Glu255Ala, Glu330Ala, all ty…PromoterCMVAvailable SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn1 bPAC cMyc T2A tDimer
Plasmid#85397Purposehumanized photoactivated adenylyl cyclase with cMyc Tag driven by neuron-specific promoter, plus red fluorescent proteinDepositorInsertshumanized photoactivated adenylyl cyclase
red fluorescent protein
UseAAVTagscMyc TagExpressionMammalianPromoterhuman synapsin-1 and ribosomal skip sequence T2AAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-NES-OptoJNKi
Plasmid#89739PurposeExpression of light-regulated JNK inhibitor, mCherry-tagged, localised to cytoplasm, wild-type photosensor, inhibitor JIP11DepositorInsertNLS-OptoJNKi
UseFluorescent proteinTagsmCherryExpressionMammalianPromoterCMVAvailable SinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
FKBP-Stx3-mCitrine
Plasmid#92428PurposeExpression of syntaxin-3 N-terminally conjugated to FKBP and C-terminally conjugated to mCitrine.DepositorInsertStx3 (Stx3 Rat)
TagsFKBP (FK506 binding protein 12); allows for heter…ExpressionMammalianPromoterCMVAvailable SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
mOC-STAMP_3xFlag-Myc-CMV26
Plasmid#73577PurposeExpress mouse OC-STAMP in mammalian cellsDepositorAvailable SinceMarch 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cx43-sfGFP
Plasmid#70053PurposeExpresses rat Cx43 (Gja1 CDS) tagged with non-monomerized sfGFP on the C-terminus. CMV promoter.DepositorInsertCx43 (Gja1 Rat)
Tagsnon-monomerized superfolder GFP (V207)Mutationfused in frame to non-monomerized superfolder GFPPromoterCMVAvailable SinceOct. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
psbA2(noATbox)-PHLS (c)
Plasmid#52308PurposeReplaces the psbA2 gene in Synechocystis with the PHLS geneDepositorInsertsbeta-phellandrene synthase
Chloramphenicol resistance
UseSynthetic BiologyExpressionBacterialMutationCAAATACA box in the psbA2 promoter to ggcgcgccPromoterpsbA2Available SinceApril 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJH131
Plasmid#48260PurposeTemplate plasmid for PCR-based transplant of Saccharomyces cerevisiae GAL10/GAL1 bidirectional promoter in yeast.DepositorInsertsURA3 3' fragment
URA3 5' fragment
GAL10/GAL1 bidirectional promoter
UseRoutine cloning vectorMutation-242 upstream to URA3 ORF +495 and URA3 ORF from …PromoterGAL10/GAL1 bidirectionalAvailable SinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGEX Grb10-SH2
Plasmid#46437DepositorInsertGrb10 (GRB10 Human)
TagsGST and PreScissionExpressionBacterialMutationcontains amino acids 435-548PromoterTacAvailable SinceJuly 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
EC.SurA.TYB1.a172-274.wt
Plasmid#15934DepositorInsertPeptidyl prolyl isomerase domain 1 of SurA (surA E. coli)
TagsinteinExpressionBacterialMutationwild typeAvailable SinceNov. 9, 2007AvailabilityAcademic Institutions and Nonprofits only -
pRSET FLIPE intramol-1m
Plasmid#13551DepositorInsertFLIP-E intramol A207W (gltI E. coli)
TagsEYFPExpressionBacterialMutationA207W, ECFP insert in binding proteinAvailable SinceDec. 15, 2006AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE-P48R-UGI
Plasmid#161817PurposeExpresses ABE-P48R-UGI in mammalian cellsDepositorInsertbpNLS-TadA7.10(P48R)-32AA linker-hSpCas9n(D10A)-10AA linker-UGI-10AA linker-UGI-bpNLS-P2A-EGFP-NLS
UseCRISPRExpressionMammalianMutationD10A in S. pyogenes Cas9, TadA mutations describe…Available SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-DENV2A-GFP-puro
Plasmid#140089PurposeFluorescence activatable reporter of DENV-2 NS2B-NS3 protease activityDepositorInsertDENV2A-GFP
UseLentiviral; Low expressionTags6XHis tag and GFPExpressionMammalianPromoterCMVAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
nuc-yHS1-M7A
Plasmid#159167PurposeNuclear labile heme reporterDepositorInsertnuc-yHS1-M7A
TagsSV40 NLSExpressionYeastMutationMutated Met 7 of the cyt b562 module of nuc-yHS1 …PromoterGPDAvailable SinceSept. 21, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
Venus1-K685R-STAT3
Plasmid#123170PurposeExpresses K658R STAT3 fused to the 1-157 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus1 (aa 1-157) (STAT3 Human)
TagsVenus1 (aa 1-158) for bimolecular fluorescence co…ExpressionMammalianMutationK685R substitutionAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDM304_DPAKa(GBD)-YFP
Plasmid#128699Purposeexpression of YFP-tagged probe for active Rac1 in Dictyostelium discoideum cellsDepositorInsertGBD domain (aa 731-890) of DPAKa
UseDictyostelium discoideum expression vectorTagsYFPMutationnoneAvailable SinceAug. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
mVenus-proα2(I)-G610C
Plasmid#119839PurposeExpresses mouse Type I procollagen α2 chain (Col1a2) with Gly610Cys mutation and mVenus between signal sequence and exon 6DepositorInsertType I procollagen α2 chain (Col1a2 Mouse)
TagsmVenusExpressionMammalianMutationCol1a2 exons 2-5 replaced by fluorescent tag, Gly…PromoterCMVAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pQE30-roGFP1-iE
Plasmid#83312PurposeInducible expression of redox sensitive GFP in bacteriaDepositorInsertroGFP1-iE
Tags6xHISExpressionBacterialMutationro1(C48S/S147C/Q204C) plus X insertion, iE betwe…PromoterT5Available SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only