We narrowed to 13,384 results for: car
-
Plasmid#63887PurposeAn AAV packaging vector that expresses ER-retained low-affinity GCaMP3 variant under control of the SYN1 promoter.DepositorInsertER-localized low-affinity GCaMP3(10.19)
UseAAVPromoterhuman SYN1Available SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
TMED3-hLOV-TEVcs-GAL4bd-VP64-V5
Plasmid#170996PurposeHiLITR transcription factor with full-length TMED3 targeting sequence (ER/Golgi)DepositorInsertTMED3(FL)-NNES-hLOV-TEVcs(ENLYFQ/M)-GAL4bd-VP64-V5 (TMED3 Synthetic)
UseLentiviral and Synthetic BiologyTagsV5ExpressionMammalianPromoterEf1-alphaAvailable SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRCreb5gRNA
Plasmid#195021PurposeSequence specific sgRNA that guide Cas9 to the genomic region encoding the bovine Creb5 DNA binding domainDepositorAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLX307 DEDD
Plasmid#117744PurposeOpen reading frame vector encoding DEDDDepositorAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
1D3 HC
Plasmid#170670PurposeMammalian Expression Plasmid of Anti-cytochrome c, 1D3 HC (Human)DepositorInsertHC of anti-cytochrome c, 1D3 (human) recombinant mouse monoclonal antibody
ExpressionMammalianAvailable SinceJuly 12, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
1D3 LC
Plasmid#170669PurposeMammalian Expression Plasmid of Anti-cytochrome c, 1D3 LC (Human)DepositorInsertLC of anti-cytochrome c, 1D3 (human) recombinant mouse monoclonal antibody
ExpressionMammalianAvailable SinceJune 10, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
sgAAVS1(B)
Plasmid#85571PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-Klf4
Plasmid#136613PurposeDox-inducible lentiviral vector expressing mouse Klf4DepositorAvailable SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.VSVg_mCherry-NLS
Plasmid#178220PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.S_mCherry-NLS
Plasmid#178219PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.HSV_mCherry-NLS
Plasmid#178216PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.HSV and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.VSVg_mCherry-NLS
Plasmid#178214PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.S_mCherry-NLS
Plasmid#178213PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.HSV_mCherry-NLS
Plasmid#178210PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.HSV and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
Frt-V5-hspB2
Plasmid#63103PurposeExpression of HSPB2 (small HSP) tagged with V5 in mammalian cellsDepositorAvailable SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEMS2112
Plasmid#49137PurposeAAV plasmid with NR2E1 (Ple264) promoter driving expression of EmGFP.DepositorInsertssAAV-Ple264-emGFP
UseAAVExpressionMammalianPromoterNR2E1Available SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET28b-PU.1-ETS
Plasmid#85734PurposeExpresses DNA-binding (ETS) domain of murine PU.1, residues 167-272DepositorInsertETS domain of murine PU.1 (residues 167-272) (Spi1 Human, Mouse)
Tags6xHis following thrombin cleavage site LVPR|GExpressionBacterialAvailable SinceFeb. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCWXPGR-pTF-DVL2deltaDIX
Plasmid#114276PurposeTET-inducible expression of DVL2 protein with a deletion of its DIX-domainDepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [D1_n-1] (GB1208)
Plasmid#75409PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [D1_n-1]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter (2-part multiplexing)DepositorInserttRNA-gRNA position [D1_n-1]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only