We narrowed to 9,474 results for: BLI
-
Plasmid#178057PurposeExpression Recording Islands (XRIs) for recording cellular physiological histories along intracellular protein self-assembly. Contains XRI subunit with FLAG tag, under UBC promoter with a FLEX switch.DepositorInsertXRI-FLAG
UseAAVTagsFLAG-MBPExpressionMammalianPromoterHuman ubiquitin C (UBC) promoterAvailable SinceOct. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
FLAG-HA-FbxO11-ΔFbox-pcDNA3.1-
Plasmid#52502Purposeexpresses human FbxO11-ΔFbox in mammalian cells with FLAG-HA tag at N-terminusDepositorInsertFbxO11 (FBXO11 Human)
TagsFLAG-HAExpressionMammalianMutationdeletion of Fbox (deleted aa 71-116)PromoterCMVAvailable SinceJuly 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-3xsgRNA_Opn1mw-RHO-Cas9N-IntN-polyA
Plasmid#165450PurposeExpress N-terminal part of split dCas9-VPR and 3 sgRNAs targeting murine Opn1mw promoterDepositorInsertsdCas9N-IntN
3x Opn1mw promoter-targeting sgRNAs
UseAAV and CRISPRExpressionMammalianPromoterU6 and short human rhodopsin promoterAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
GAG-CRErec
Plasmid#119971PurposeExpresses GAG (FMLV) fused with CRE recombinase for the production of VLPs loaded with CRE proteinDepositorInsertGAG-nlsCRErec
TagsnlsExpressionMammalianPromoterhCMVAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDF RBP-FL P53
Plasmid#174042PurposeExpress Full length P53 in E.coli with cleavable expression/purification tag (ribose binding protein)DepositorInsertP53 gene (TP53 Human)
TagsThermoanaerobacter Tencongenesis ribose binding p…ExpressionBacterialPromoterT7Available SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
BICstim-Gag-dCAS9-VPR
Plasmid#120922Purposeencodes a GAG-dCAS9-VPR fusion for targeted transcriptional activation.DepositorInsertGAG (FMLV)-dCAS9-VPR
TagsnoneExpressionMammalianPromoterhCMVAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
peSCBE3-NG
Plasmid#218163PurposeThis plasmid harbors the base editor eSCBE3-NG along with an sgRNA cloning cassette, facilitating high-efficiency cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsescbe3-NG
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutation in the portion of deaminase hAPOBEC3A : …PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-NG
Plasmid#218159PurposeThis plasmid harbors the base editor SCBE3-NG along with an sgRNA cloning cassette, facilitating cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsscbe3-NG
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / L1111…PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
NanoBRET BiBRET Vector, NanoLuc-HRAS WT-CRAF RBD-HaloTag
Plasmid#236861PurposeExpress NanoLuc(R)-HRAS WT-CRAF RBD-HaloTag(R) in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoBRET BiBRET Vector HaloTag-HRAS WT-BRAF RBD-NanoLuc
Plasmid#236850PurposeExpress HaloTag(R)-HRAS WT-BRAF RBD-NanoLuc(R) in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
BII-BCA-Prom-ASCL2
Plasmid#133394PurposePiggybac vector for heterologous promoter reporter assay of human ASCL2 promoterDepositorInsertdestabilized tdTomato-NLS and destabilized NLS-GFP
ExpressionMammalianMutationN/APromoterCMV enhancer and hEf1a (CpG free) drives expressi…Available SinceJan. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
SSpB-HaloTag-p63DH
Plasmid#176116PurposeHeterodimerization with iLID, RhoA activationDepositorInsertRHOGEF p63 (ARHGEF25 Human)
ExpressionMammalianAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
SSpB-mCherry-p63DH
Plasmid#176112PurposeHeterodimerization with iLID, RhoA activationDepositorInsertRHOGEF p63 (ARHGEF25 Human)
ExpressionMammalianAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-RRBP1-WPRE-UbC-Emerald
Plasmid#225942PurposeLentiviral vector plasmid expressing human ribosome binding protein 1 (RRBP1) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianPromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-FHC-POLQ-S1977P
Plasmid#64876Purposelentiviral expression of human POLQ S1977P mutant (mimicks the chaos1 mutation)DepositorInsertPOLQ (POLQ Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationS1977P, mimicking the chaos1 mutationPromoterEF1alphaAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
FLAG-HA-FbxO11-Jeff-pcDNA3.1-
Plasmid#52503Purposeexpresses human FbxO11-Jeff mutant in mammalian cells with FLAG-HA tag at N-terminusDepositorAvailable SinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetO-ePOUSKM
Plasmid#206398PurposeExpresses four genes (human ePOU, SOX2, KLF4, c-MYC) in mammalian cells, for lentivirus generation.DepositorAvailable SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBABE MD-deltaN-ER
Plasmid#13496DepositorInsertMyoD1-Estrogen Receptor Fusion Protein (Myod1 Mouse, Human)
UseRetroviralExpressionMammalianMutationMyoD (containing a deletion in aa3-56) was fused …Available SinceDec. 29, 2006AvailabilityAcademic Institutions and Nonprofits only