We narrowed to 15,910 results for: grna
-
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available sinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCJH009_proD_Cas12c-sgRNA-GFP_CAM
Plasmid#183070PurposePlasmid expressing Cas12c sgRNA targeting GFP (1) for in vivo interference assay in bacteria.DepositorInsertCas12c single guide RNA targeting GFP
UseCRISPRExpressionBacterialAvailable sinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9-KRAB_sgRNA Td2
Plasmid#176264PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged to the KRAB domain and Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_Tuba1b sgRNA / hSpCas9
Plasmid#172835PurposeMammalian expression of a sgRNA targeting the intron 1 of Tuba1b (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Tuba1b under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i1 sgRNA / hSpCas9
Plasmid#172825PurposeMammalian expression of a sgRNA targeting the intron 1 position 1 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_rSyn1 sgRNA / hSpCas9
Plasmid#172840PurposeMammalian expression of a sgRNA targeting the intron 21 (last intron) of rSyn1 (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 21 of rSyn1 under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_rActb sgRNA / hSpCas9
Plasmid#172833PurposeMammalian expression of a sgRNA targeting the intron 1of rat Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of rActb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
Spy EMX1-pegRNA
Plasmid#169855PurposeSpyCas9-pegRNA for EMX1DepositorInsertSpy EMX1-pegRNA
ExpressionMammalianPromoterhuman U6 promoterAvailable sinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-pegRNA_HOXD13_CtoT-EGFP
Plasmid#159792PurposeS. pyogenes pegRNA for C to T mutation at the HOXD13 site of mouse cells using prime editingDepositorInsertspacer of pegRNA_HOXD13_CtoT targeting HOXD13 gene (HOXD13 Human)
ExpressionMammalianAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-pegRNA_HOXD13_CtoG-EGFP
Plasmid#159791PurposeS. pyogenes pegRNA for C to G mutation at the HOXD13 site of mouse cells using prime editingDepositorInsertspacer of pegRNA_HOXD13_CtoG targeting HOXD13 gene (HOXD13 Human)
ExpressionMammalianAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA_SRD5A1-mcherry
Plasmid#159780PurposeS. pyogenes sgRNA collocated with pegRNA targeting human SRD5A1 geneDepositorInsertspacer of sgRNA targeting SRD5A1 gene (SRD5A1 Human)
ExpressionMammalianAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA_EMX1-mcherry
Plasmid#159784PurposeS. pyogenes sgRNA collocated with pegRNA targeting human EMX1 geneDepositorInsertspacer of sgRNA targeting EMX1gene (EMX1 Human)
ExpressionMammalianAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA_KCNA1-mcherry
Plasmid#159788PurposeS. pyogenes sgRNA collocated with pegRNA targeting human KCNA1 geneDepositorInsertspacer of sgRNA targeting KCNA1 gene (KCNA1 Human)
ExpressionMammalianAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA_SRD5A3-mcherry
Plasmid#159782PurposeS. pyogenes sgRNA collocated with pegRNA targeting human SRD5A3 geneDepositorInsertspacer of sgRNA targeting SRD5A3 gene (SRD5A3 Human)
ExpressionMammalianAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA_HOXD13-mcherry
Plasmid#159793PurposeS. pyogenes sgRNA collocated with pegRNA targeting mouse HOXD13 geneDepositorInsertspacer of sgRNA targeting HOXD13 gene (HOXD13 Human)
ExpressionMammalianAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA1 T922I
Plasmid#139328PurposePlasmid expressing a sgRNA to introduce BRCA1 T922I using base editingDepositorInsertsgRNA to insert BRCA1 T922I using base editing
ExpressionMammalianPromoterU6Available sinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA1 Q1779Stop
Plasmid#139331PurposePlasmid expressing a sgRNA to introduce BRCA1 Q1779Stop using base editingDepositorInsertsgRNA to insert BRCA1 Q1779Stop using base editing
ExpressionMammalianPromoterU6Available sinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
px459-RhebL1 sgRNA
Plasmid#133769PurposeExpresses Cas9 and human RhebL1 sgRNADepositorInsertRhebL1 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
px459-Rheb sgRNA
Plasmid#133768PurposeExpresses Cas9 and human Rheb sgRNADepositorInsertRheb sgRNA
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only