171,674 results
-
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
PH-Akt-GFP
Plasmid#51465PurposeIs a biosensor for PIP3/PI(3,4)P2DepositorInsertAKT (aa 1–164)
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceMarch 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-1(nsp8-nsp7)(nsp12)
Plasmid#165451PurposeExpresses the RNA Dependent RNA polymerase complex of SARS-CoV-2 in Escherichia ColiDepositorInsertsnsp12
nsp8
nsp7
Tags14Histidine-TEVExpressionBacterialPromoterT7Available SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28 MBP_PrA/G-H6
Plasmid#176077PurposeExpress His6 tagged MBP_PrA/G in Escherichia coliDepositorInsertMBP PrA/G-H6
TagsHis tagExpressionBacterialPromoterT7 PromoterAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRSET-6xTR-TUBE
Plasmid#110313PurposeE. coli expression and purification of 6xTR-TUBEDepositorInsert6xTR-TUBE (UBQLN1 Human)
TagsN-terminal His6-T7 tagExpressionBacterialMutationAll Arg residues in the UBA domain are mutated to…PromoterT7Available SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 neo
Plasmid#13425Purpose3rd gen lentiviral backbone for cloning and expression of new shRNA sequences. Uses neomycin for selection.DepositorInsertnon-hairpin 18bp
UseLentiviral and RNAiExpressionMammalianPromoterU6 promoterAvailable SinceDec. 22, 2006AvailabilityAcademic Institutions and Nonprofits only -
AAV2-ITR-pEFS-NLS_hfCas13d(RfxCas13d_N2V8)_FLAG_NLS-pA-U6-DR-Pcsk9-sg5-DR-Pcsk9-sg6-DR-AAV2-ITR
Plasmid#191795Purposevector for encoding and AAV packaging a human codon-optimized High-fidelity RfxCas13d (hfCas13d) driven by EFS promoter, Pcsk9-target guide RNAs compatible with RfxCas13d driven by hU6DepositorInserthumanized hfCas13d
UseAAV and CRISPRExpressionMammalianMutationA134V, A140V, A141V, A143VPromoterEFS, hU6Available SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pScI_dCas9-CDA_J23119-sgRNA
Plasmid#108550PurposeBacterial Target-AID vector with sgRNADepositorInsertsdCas9-PmCDA1
Streptococcus pyogenes sgRNA
TagsFlagExpressionBacterialMutationD10A and H840A for SpCas9PromoterJ23119 and lambda ORAvailable SinceSept. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
SPLICS PM-ER Long P2A
Plasmid#164111PurposeDetect the long Plasma membrane-Endoplasmic reticulum contactDepositorInsertSplit YFP PM-ER Long P2A
ExpressionMammalianAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBAV1K-T5-gfp
Plasmid#26702DepositorInsertT5lacOlacOeGFP biobrick
ExpressionBacterialAvailable SinceNov. 15, 2010AvailabilityAcademic Institutions and Nonprofits only