We narrowed to 11,712 results for: NSI
-
Plasmid#158263PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.VSVg.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_FLAG.VSVg.C_NGFR
Plasmid#158260PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsFLAG.VSVg.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II no force control (F40-based)
Plasmid#118716PurposeThe no force control for the F40-based human desmoplakin II tension sensor serves to detect changes in FRET between YPet(short) and mCherry that are tension-independent.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)-F40-mCherry] (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherryExpressionMammalianMutationtruncation after aa1353PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-BRD9_BRG1BD-PGK-Puro-IRES-GFP
Plasmid#75121PurposeRetroviral expression plasmid encoding a human BRD9 bromodomain-swap mutant containing the BRG1 bromodomainDepositorAvailable SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-BRD9_BRD1BD-PGK-Puro-IRES-GFP
Plasmid#75119PurposeRetroviral expression plasmid encoding a human BRD9 bromodomain-swap mutant containing the BRD1 bromodomainDepositorAvailable SinceMay 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR207 SARS-CoV-2 E 27nt-del_nostop
Plasmid#153955PurposeGateway-compatible Entry vector, with insert of E CDS bearing a 27nt deletion from SARS-CoV-2 genomic analysis in Davidson et al. 2020DepositorInsertE (E SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorMutationMany synonymous changes due to codon optimizationAvailable SinceJune 23, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223 SARS-CoV2 TEV-NSP8
Plasmid#154407PurposeGateway-compatible Entry vectorDepositorInsertNSP8 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vector, with insert of n…MutationMany synonymous changes due to codon optimizationAvailable SinceJuly 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
BRI1 BRI1_pECIA14
Plasmid#114886PurposePrey vector BRI1 BRI1_pECIA14 should be used with bait vector BRI1 BRI1_pECIA2.DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-Archon1-KGC-EGFP
Plasmid#108418PurposeAAV production plasmid encoding for Archon1 fluorescent voltage reporterDepositorInsertArchon1-KGC-EGFP
UseAAVExpressionMammalianPromoterCaMKIIAvailable SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 UQCC2(5’UTR)-FF
Plasmid#85487PurposeFirefly luciferase under the control of UQCC2 5'UTRDepositorAvailable SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_DM1-3_H0-ABD+
Plasmid#234554PurposeCTNNA1 M-domain deletion mutant with enhanced actin-binding domain mutationsDepositorAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-SUMO-m-cGAS(I309T)
Plasmid#232295PurposeExpression of mutant mouse cGAS protein (I309T)DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
BPK1520-sgRNA GLB1
Plasmid#184378PurposeExpresses a sgRNA to edit GLB1 gene NM_000404.2_c.907A>GDepositorAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA893 - pBA904 Puro-T2A-BFP KLF5 g1 CRISPRa guide guide (pRCA594 backbone) 666
Plasmid#238186PurposeLentiviral CRISPR guide vector expressing a KLF5 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-Plxnd1 sesRNA-2a-msFlag-2a-tTA2-WPRE
Plasmid#239032PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceAug. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA860 - pBA904 Puro-T2A-GFP EGR3 g1 CRISPRa guide guide (pRCA360 backbone)
Plasmid#238188PurposeLentiviral CRISPR guide vector expressing a EGR3 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hBIRC3_1k)-PGKpuro2ABFP-W
Plasmid#208418PurposeLentiviral gRNA plasmid targeting human BIRC3 gene, co-expression of BFP tagDepositorInsertBIRC3 (BIRC3 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hBIRC3_2b)-PGKpuro2ABFP-W
Plasmid#208419PurposeLentiviral gRNA plasmid targeting human BIRC3 gene, co-expression of BFP tagDepositorInsertBIRC3 (BIRC3 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hCASP8_1k)-PGKpuro2ABFP-W
Plasmid#208422PurposeLentiviral gRNA plasmid targeting human CASP8 gene, co-expression of BFP tagDepositorInsertCASP8 (CASP8 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only