We narrowed to 11,356 results for: aga
-
Plasmid#87741PurposeIPTG-inducible expression of T4 DNA ligase for protein purificationDepositorAvailable SinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pDD428
Plasmid#202081PurposeCas9/sgRNA plasmid targeting the C-terminus of Myh9DepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-u6-gRNA(deltaD1)-hSyn-mCherry
Plasmid#231400PurposeKnockdown of DRD1 across rodent speciesDepositorInsertsgRNA(DRD1.2)
UseAAV and CRISPRExpressionMammalianPromoteru6Available SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB025
Plasmid#183092PurposeExpresses FnCas12a in Bacteroides and used for genome editingDepositorInsertFnCas12a, gRNA, Promoter, HAB, TetR,
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP1TDPGH023Available SinceAug. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
p5’UTR-ORF1
Plasmid#190566PurposeHolding vector containing the contiguous 5’UTR and ORF1 regions of human L1 (L1.3) to facilitate subcloning of ORF1 mutants into the full-length L1 reporter pRTC2-puro (Cook et al., 2015).DepositorInsertContiguous regions of the human L1 (L1.3) 5’UTR and ORF1
UseFor dna propagation onlyExpressionBacterialPromoterN/AAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
mNeonGreen-Smad3
Plasmid#172098PurposeExpresses fluorescently tagged human Smad3 in mammalian cells.DepositorInsertSmad 3 (Smad3 Mouse)
TagsmNeonGreenExpressionMammalianMutationC49S mutation in mCeruleanPromoterCMVAvailable SinceDec. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCfB5191
Plasmid#126911PurposePlasmid containing gRNA expression cassettes targeting the X-4 and XII-5 integration sites in Saccharomyces cerevisiaeDepositorInsertX-4 and XII-5 gRNA
UseCRISPRAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
scFv-GCN4-sfGFP-TET1CD
Plasmid#184439PurposeTET1 catalytic domain fused with sfGFP and scFv against GCN4DepositorInsertscFv-GCN4-sfGFP-TET1CD
UseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_HDAC1
Plasmid#183297PurposeAll-in-One CRISPRko system with a guide RNA that targets HDAC1 geneDepositorInsertHDAC1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR_eGFP_497
Plasmid#111824PurposeKnockout eGFPDepositorInsertgRNA targeting eGFP 477-497
UseCRISPRTagsmCherryExpressionBacterial and MammalianPromoterU6Available SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgMSLN
Plasmid#193588PurposeMSLN knockoutDepositorInsertsgMSLN (MSLN Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_SpCas9_USP7 Exon 3 gRNA
Plasmid#131257PurposepX330-U6-Chimeric_BB-Cbh-hSpCas9 vector expressing a guide RNA targeting exon 3 of USP7DepositorInserthumanised S. pyogenes Cas9 nuclease
ExpressionMammalianAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAC-crRNA-Km
Plasmid#158712PurposePlasmids containing the medium-copy-number p15A origin of replication can be propagated in E. coli cells and a non-targeting crRNADepositorInsertAcGFP (for crRNA cloning)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterTetOAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX458_TEAD1_1
Plasmid#86356PurposeEncodes gRNA for 3' target of human TEAD1DepositorInsertgRNA against TEAD1 (TEAD1 Human)
UseCRISPRAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_TEAD3_1
Plasmid#86337PurposeEncodes gRNA for 3' target of human TEAD3DepositorInsertgRNA against TEAD3 (TEAD3 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDT-sgRNA
Plasmid#138271PurposeDual-targeting sgRNA vector that contains both a sgRNA against BFP (sgBG) and a sgRNA for a genomic target site (sgTS)DepositorInsertsgBG, sgTS
UseCRISPRExpressionMammalianAvailable SinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-scr
Plasmid#169795PurposeExpresses Cas9 and guide RNA with untarget sequence generated by scramble of the target sequence of LentiCRISPRv2-ACTB-C1..DepositorInsertScrambled guide RNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAF257
Plasmid#105497PurposepRPF185 derived plasmid encoding an anhydrotetracyclin inducible SmBiT and HupA-LgBiTDepositorInsertSmBiT/HupA-LgBiT
UseAtc-dependent expression in c. difficilePromoterPtetAvailable SinceSept. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_HLA_class_I_1
Plasmid#164986PurposeExpression of gRNA targeting multiple HLA-A, HLA-B, and HLA-C genesDepositorInsertgRNA against HLA class I
UseCRISPRExpressionMammalianAvailable SinceMarch 23, 2021AvailabilityAcademic Institutions and Nonprofits only