We narrowed to 14,497 results for: SHR;
-
Plasmid#158705PurposeCD45 CRISPRa controlDepositorInsertCD45 (PTPRC Human)
UseLentiviralAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
P789_pY026_EnAsCpf1_CLYBL_T1_catRNA
Plasmid#202760PurposeEncodes for CRISPR-Cas12a (EnAsCpf1) with gRNA for targeting the CLYBL safe harbor siteDepositorInserthuAsCpf1
ExpressionMammalianPromoterCMVAvailable SinceFeb. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSPCas9(BB)-2A-GFP_ABCA3GFP_targeting
Plasmid#188541PurposePlasmid encoding pCas9 and gRNA targeting the endogenous human ABCA3 locus stop codonDepositorInsertgRNA
UseCRISPRTagsGFPPromoterU6Available SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001148862)
Plasmid#80263Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330A-nBRD4/PITCh
Plasmid#91794PurposePITCh sgRNA, N-terminal BRD4 sgRNA, and Cas9 expressing plasmid for use with the dTAG knock-in system and BRD4DepositorInsertSpCas9
UseCRISPRExpressionMammalianPromoterchicken β-actin promoterAvailable SinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDF0338 pAAV U6-HvsCas7-11 DR Rev-BpiI golden gate backbone dual vector
Plasmid#172514PurposeEncodes HvsCas7-11 DR and golden gate site for spacer clonings in an AAV backbone with U6 promoterDepositorInsertpAAV U6-HvsCas7-11 DR Rev-BpiI golden gate backbone dual vector
UseAAVAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_gRNA
Plasmid#196139PurposegRNA targeting the AAVS1 locus in a third generation Cas9 backbone with GFPDepositorInsertAAVS1 gRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pLV_hU6-sgRNA_hUbC-dCas9-ZIM3-KRAB-T2a-PuroR
Plasmid#172982Purposecontrol & cloning vector for CRISPRi expressing dead Cas9-ZIM3-KRAB fusionDepositorInsertcontrol sgRNA
UseCRISPR and LentiviralAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
PKMYT1 gRNA (BRDN0001146750)
Plasmid#77280Purpose3rd generation lentiviral gRNA plasmid targeting human PKMYT1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKMYT1 gRNA (BRDN0001146095)
Plasmid#77278Purpose3rd generation lentiviral gRNA plasmid targeting human PKMYT1DepositorAvailable SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
p6347 MSCV-CMV-Flag-HA-Brd4-444-722
Plasmid#31353DepositorAvailable SinceOct. 20, 2011AvailabilityAcademic Institutions and Nonprofits only -
BLADE-182
Plasmid#134914PurposesgRNA targeting GFP to be used in nanoblade systemDepositorInsertGFP
UseCRISPR and Synthetic BiologyPromoterU6Available SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX462-hPRKAA1-gRNA_B
Plasmid#74375PurposegRNA_B to knockout human AMPK alpha 1 using Cas9nDepositorAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX462-hPRKAA1-gRNA_A
Plasmid#74374PurposegRNA_A to knockout human AMPK alpha 1 using Cas9nDepositorAvailable SinceApril 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-MCS-pA
Plasmid#233031PurposeTo express a DjCas13d-compatible gRNADepositorInsertDjCas13d-compatible gRNA expression cassette
UseAAVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAX198
Plasmid#173042PurposeCustom vector for sgRNA library constructionDepositorInsertHBB Gene - Second and third exons of ENST00000647020.1 (no intron) and part of the 3' UTR (HBB Human)
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ14901
Plasmid#239276PurposeExpresses gG1 for pertubing endogenous human GAPDH mRNA via CRISPR-TODepositorAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cas9-GFP_sg_mTfeb
Plasmid#79006PurposeExpresses WT Cas9 and GFP, along with a sgRNA to mouse Tfeb.DepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only