We narrowed to 9,961 results for: crispr plasmids
-
Plasmid#112307PurposeCRISPR donor plasmid to tag human transcription factor ZNF75A with GFPDepositorInsertZNF75A homology arms flanking EGFP-IRES-Neo cassette (ZNF75A Human)
UseCRISPRMutationhg38:16:3317462:A>T, hg38:16:3317715:C>T, h…Available SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF764-donor
Plasmid#112298PurposeCRISPR donor plasmid to tag human transcription factor ZNF764 with GFPDepositorInsertZNF764 homology arms flanking EGFP-IRES-Neo cassette (ZNF764 Human)
UseCRISPRMutationhg38:16:30555233:G>A, hg38:16:30555234:C>G,…Available SinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSmart-Nm-sgRNA-BbsI
Plasmid#49157PurposePlasmid for cloning spacer into sgRNA for NmCas9DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLCNICK
Plasmid#84653PurposeGenome editing for Lactobacillus casei Lc2WDepositorInsertsCas9 nickase
sgRNA
homology arms of LC2W_2179
UseCRISPRMutationD10AAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCP-tRNA
Plasmid#133812PurposeCRISPR-Cas9 system for genetic manipulation of Candida parapsilosis, C. orthopsilosis, and C. metapsilosisDepositorInsertcassette for the expression of the sgRNA from the C. parapsilosis RNA pol II GAPDH promoter
UseCRISPRAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCT-tRNA
Plasmid#133813PurposeCRISPR-Cas9 system for genetic manipulation of Candida tropicalisDepositorInsertcassette for the expression of the sgRNA from the Ashbya gossypii RNA pol II TEF1 promoter
UseCRISPRAvailable SinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ143
Plasmid#69295PurposeGolden Gate recipient and Gateway entry vector; assembly of 3 gRNAsDepositorTypeEmpty backboneUseCRISPRAvailable SinceNov. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTF-lacZ
Plasmid#153036PurposeFor CRISPR-Cas12a genome editing in E. coli for the insertion of large DNA fragments at the lacZ locus. Contains a constitutively expressed CRISPR array targeting the lacZ gene . No cargo DNA.DepositorInsertCRISPR array
ExpressionBacterialAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTF-ahpC-rfp
Plasmid#153035PurposeFor CRISPR-Cas12a genome editing in E. coli. Contains a constituitively expressed CRISPR array targeting the ahpC gene in E. coli and donor DNA to insert an rfp translational fusion in the ahpC gene.DepositorInsertCRISPR array
ExpressionBacterialAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTF-lacZ-rfp
Plasmid#153037PurposeCRISPR-Cas12a genome editing in E. coli. Contains a constitutively CRISPR array targeting the lacZ gene in E. coli genome and donor DNA to insert an constitutively expressed rfp reporter gene.DepositorInsertCRISPR array
ExpressionBacterialAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTOX-donor
Plasmid#132516PurposeCRISPR donor plasmid to create GFP fusion proteinsDepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTBX18-donor
Plasmid#176370PurposeCRISPR donor plasmid to create GFP fusion proteinsDepositorAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZBED9.1.1-gDNA
Plasmid#175854PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZBED9-Nickase1
UseCRISPRAvailable SinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZBED9.1.2-gDNA
Plasmid#175853PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZBED9-Nickase2
UseCRISPRAvailable SinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDX4.1.1-gDNA
Plasmid#175852PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertCDX4-Nickase1
UseCRISPRAvailable SinceDec. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDX4.1.2-gDNA
Plasmid#175851PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertCDX4-Nickase2
UseCRISPRAvailable SinceDec. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZNF468-donor
Plasmid#176350PurposeCRISPR donor plasmid to create GFP fusion proteinsDepositorAvailable SinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
ZMAT4.1.1-gDNA
Plasmid#175871PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZMAT4-Nickase1
UseCRISPRAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
ZMAT4.1.2-gDNA
Plasmid#175872PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZMAT4-Nickase2
UseCRISPRAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only