We narrowed to 2,488 results for: dCas9
-
Plasmid#216531PurposeTargeting vector for CRISPRd generationDepositorInsertABI-dCas9-mCherry
UseCRISPRTagsmCherryExpressionMammalianPromoterTRE3GAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUbi_dCas9-BFP-KRAB-gRNA
Plasmid#221503PurposeCRISPRi machinery fish codon optimized expressing plasmidDepositorInsertdCas9-tagBFP-KRAB
UseFish expressionMutationD10A and H839A point mutationsPromoterZebrafish Ubiquitin promoterAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCD175
Plasmid#113316PurposedCas9, MCP-AsiA, rpoD_F563YDepositorInsertdCas9, MCP-T4.AsiA, rpoD_F563Y
UseCRISPRExpressionBacterialMutationF563YAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-sgRNA Nestin-dCas9-KRAB-T2a-GFP
Plasmid#196988PurposeDerived from pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP, custom sgRNA cloning vectorDepositorInsertNestin-dCas9-KRAB-T2a-GFP
UseCRISPR and LentiviralAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHelper-CRISPRi-sgRNA
Plasmid#221135PurposeHelper plasmid for sgRNA cloning for CRISPRi. sgRNA-scaffold with dCas9 handle expressed from constitutive bacterial promoter J23119(SpeI). 2 BbsI sites for sgRNA cloning.DepositorInsertsgRNA-scaffold with dCas9 handle
UseCRISPRExpressionBacterialPromoterJ23119(SpeI)Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
SL2-sgTelo-MTSa/BFP/pdCas9-C1
Plasmid#162760PurposeExpressing dCas9 and sgRNA containg MTSa targeting telomeresDepositorInsertdCas9 and sgRNA(SL2-sgTelo-MTSa)
ExpressionMammalianMutationdCas9(nuclease deactivated Cas9)PromoterU6/CMVAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pLV_hU6-sgRNA_hUbC-dCas9-ZIM3-KRAB-T2a-PuroR
Plasmid#172982Purposecontrol & cloning vector for CRISPRi expressing dead Cas9-ZIM3-KRAB fusionDepositorInsertcontrol sgRNA
UseCRISPR and LentiviralAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-R1R2_EF1adCas9p300_T2A_MS2p65HSF1-IRESbsdpA
Plasmid#113342PurposeExpresses dCas9-p300 and MS2-p65-HSF1 fusion proteinsDepositorInsertdCas9-p300core-T2A-MS2-p65-HSF1
UsePiggybacAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGinB-8X(GGS)-dCas9-FLAG-NLS_SpecR
Plasmid#81206PurposeCMV promoter driving expression of GinB catalytic domain fused with linker to dCas9 in the order shown. Has a FLAG and NLS tag on the c-terminus. Spec resistanceDepositorInsertpGinB-8X(GGS)-dCas9-FLAG-NLS
ExpressionMammalianPromoterCMVAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_NOT_i1
Plasmid#231416PurposeThis NOT-gate plasmid expresses dCas9 from a constitutive promoter, and GFP from a promoter repressible by sgRNA-1.DepositorInsertsdCas9
GFP
UseSynthetic BiologyAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
PB_p300_core-dCas9-EGFP_hygro
Plasmid#226431PurposePiggyBac transposon vector containing a dox inducible p300 core-dCas9 fusion protein and EGFP reporter. Hygromycin selection markerDepositorInsertsp300 core-dCas9-EGFP fusion protein
rtTA3-IRES-Hygro
UseCRISPR and Synthetic Biology; Piggybac transposonTagsHA tag, P2A-EGFP, and p300 coreExpressionMammalianPromoterDox inducible minimal CMV and UbC PromoterAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
Pinducer20-dCas9-SunTag-2A-BFP
Plasmid#115779Purposetargeted DNA methylation toolDepositorInsertdCas9-SunTag-2A-BFP
ExpressionMammalianPromoterTREAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_NOT_iC
Plasmid#231418PurposeThis NOT-gate plasmid expresses dCas9 from a constitutive promoter, and GFP from a promoter repressible by sgRNA-C1. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ290.)DepositorInsertsdCas9
GFP
UseSynthetic BiologyAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_NOT_iA
Plasmid#231417PurposeThis NOT-gate plasmid expresses dCas9 from a constitutive promoter, and GFP from a promoter repressible by sgRNA-A1. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ285.)DepositorInsertsdCas9
GFP
UseSynthetic BiologyAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 EGFP-guide2
Plasmid#118167PurposeCRISPRa negative control. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR, and sgRNA2 against the EGFP CDSDepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR EGFP-guide3
Plasmid#118164PurposeCRISPRi negative control. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter, and sgRNA3 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
p2T-CMV-ABE8e_dNRCH-BlastR
Plasmid#232720PurposeA-to-G base editorDepositorInsertABE8e-dCas9(NRCH)
ExpressionMammalianMutationwithin Cas9 D10A H840AAvailable SinceMarch 3, 2025AvailabilityAcademic Institutions and Nonprofits only