We narrowed to 14,449 results for: RING;
-
Plasmid#217971PurposeProvides expression from a CMV promoter surrounded by insulators. Integrates via piggyBac transposase. Confers puromycin resistance. Expresses nuclear localized BFP. High copy plasmid.DepositorInsert2xcHS4::mCherry-IRES-PuroR-mTagBFP2-NLS::2xcHS4
ExpressionMammalianAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-NE2h
Plasmid#208687PurposeExpresses the genetically-encoded fluorescent norepinephrine (NE) sensor GRAB_NE2h in neuronsDepositorHas ServiceAAV5InsertGPCR activation based norepinephrine (NE) sensor GRAB_NE2h
UseAAVPromoterhSynAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJAM1.19_PB-CIT-PGK-Blast
Plasmid#205564PurposeExpress human CITDepositorAvailable SinceSept. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Actin-7
Plasmid#56421PurposeLocalization: Actin, Excitation: 488, Emission: 507DepositorAvailable SinceDec. 23, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hChR2(H134R)-EYFP
Plasmid#26969PurposeAAV expression of humanized ChR2(H134R) fused to EYFP driven by CaMKIIa promoter for optogenetic activationDepositorHas ServiceAAV1, AAV2, AAV5, and AAV9InserthChR2(H134R)
UseAAVTagsEYFPExpressionMammalianMutationHistidine 134 is mutated to ArgininePromoterCaMKIIaAvailable SinceFeb. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
TRE-UBC-HLA-G SCT-T2A-GFP
Plasmid#205462Purposelentiviral plasmid for expression of HLA-G SCTDepositorAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAFNF-Venus-Actb
Plasmid#169788PurposeAn actin FRET sensor. Must be expressed with ECFP-actin for FRET.DepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-GRAB_rDA1h
Plasmid#140557PurposeExpresses the red fluorescent high-affinity DA sensor GRAB_rDA1h in neuronsDepositorHas ServiceAAV9InsertRed fluorescent DA sensor GRAB_rDA1h (high affinity)
UseAAVPromoterhSynAvailable SinceJuly 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
Oct4-IRES-eGFP-PGK-Neo
Plasmid#48681PurposeFor knock-in donor vector by CRISPR/CAS systemDepositorAvailable SinceSept. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
TfR-sfGFP-myc tag-SpyCatcher003
Plasmid#133451PurposeExpresses SpyCatcher003 for display at the cell surface of mammalian cells, with superfolder GFP for visualization and myc tag for antibody detectionDepositorInsertTfR-sfGFP-myc tag-SpyCatcher003
TagsGSSGS and myc tagExpressionMammalianMutationContains C20 and A23 mutations that improve plasm…PromoterCMVAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
peGFPC2-CARKL
Plasmid#51748Purposeexpression of eGFP-fused mouse sedoheptulokinase (CARKL, SHPK)DepositorAvailable SinceMarch 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMVtight-UPRT-T2A-RFP-IRES-CD
Plasmid#126677PurposeDoxycycline inducible expression of UPRT and CD along with reporter RFPDepositorInsertUPRT-T2A-RFP-IRES-CD (FCY1 Toxoplasma gondii, Budding Yeast)
Promotertight TREAvailable SinceJune 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
PGK-H2BeGFP
Plasmid#21210DepositorAvailable SinceJuly 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Flag beta-2-adrenergic-receptor
Plasmid#14697DepositorAvailable SinceJune 19, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-STChRger2-TS-EYFP
Plasmid#129395PurposeSoma Targeted, High photocurrent, low-light sensitive channelrhodopsin (ChRger2) for optogenetic activation with systemic delivery or for low-light activation. Driven by human Synapsin I promoter.DepositorInsertsoma targeted ChRger2
UseAAVTagsKv2.1-TS-EYFPExpressionMammalianPromoterhSynAvailable SinceOct. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_r5-HT1.0
Plasmid#208719PurposeExpresses the red 5-HT sensor GRAB_r5-HT1.0 in neuronsDepositorInsertRed fluorescent 5-HT sensor GRAB_r5-HT1.0
UseAAVPromoterhSynAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBI-CMV1-mir451-CMV2-mir1
Plasmid#164635PurposeExpress miR-451 and miR-1-1 in mammalian cellsDepositorAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLNCX2-mEGFP-CHMP2B
Plasmid#115329Purposeexpresses mEGFP-CHMP2B in mammalian cellsDepositorAvailable SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-GRAB_r5-HT1.0
Plasmid#208713PurposeExpresses the red 5-HT sensor GRAB_r5-HT1.0 in mammalian cellsDepositorInsertRed fluorescent 5-HT sensor GRAB_r5-HT1.0
ExpressionMammalianPromoterCMVAvailable SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only