We narrowed to 4,936 results for: AAT
-
Plasmid#159614PurposeBacterial expression plasmid for COVID-SARS2 NSP13 helicaseDepositorInsertCovid-SARS2 Nsp13
TagsHis6-Zb-TEVExpressionBacterialMutationCodon-optimized for E. coli expressionPromoterT7 - LacOAvailable SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shNRF2 #1
Plasmid#136584PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorAvailable SinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
EGFP-SPN_ARR Q37A/R38A/N52R (Shank3)
Plasmid#175256PurposeSPN-ARR fragment with structure opening N52R and actin binding site Q37A/R38A mutations in EGFP backbone for mammalian expressionDepositorInsertSPN-ARR fragment with Q37A/R38A/N52R mutations from SHANK3
ExpressionMammalianAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
CCM2(FL)_pET49b
Plasmid#224066PurposeBacterial expression of full-length CCM2 fused to an N-terminal GST. HRV-3C cleavage siteDepositorAvailable SinceAug. 26, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
ACE2
Plasmid#164219PurposeExpresses full length human ACE2 protein, along with TagBFP reporter and Puromycin selection markerDepositorInsertACE2 (ACE2 Human)
UseLentiviralMutationsilent mutation to remove internal EcoRI site (GA…PromoterCMVAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shID2 #1
Plasmid#83086PurposeLentiviral shRNA vector for inducible knockdown of human ID2DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHR-HP1α-miRFP670-Cry2WT
Plasmid#122442PurposeExpresses disordered protein HP1α fused with fluorescent protein miRFP670 and optogenetic protein Cry2WTDepositorInsertHP1 alpha (CBX5 Human)
UseLentiviralTagsCry2WT and miRFP670ExpressionMammalianPromoterSFFVAvailable SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shYAP1-1
Plasmid#193692PurposeConstitutive lentiviral expression of YAP1 shRNADepositorInsertYAP1 (YAP1 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-LRPPRC-ts1
Plasmid#174268PurposeLRPPRC knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0-Anillin shRNA
Plasmid#187270PurposeLentiviral expression of shRNA targeting AnillinDepositorAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCyCEN_Lisp2mCherry_hsp70_GFP
Plasmid#137169PurposeDual fluorescent reporter for liver stage expression in Plasmodium cynomolgiDepositorInsertsmCherry
Nanoluc
dihydrofolate reductase
Green Fluorescent Protein
UseUnspecifiedTagsT2APromoterP. cynomolgi hsp70 and P. cynomolgi lisp2Available SinceMay 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-SCGB3A2_gRNA1-SpCas9-T2A-GFP
Plasmid#126698Purposeto express Cas9 from S. pyogenes with 2A-EGFP and sgRNA targeting human SCGB3A2 locus at the end of the endogenous coding sequenceDepositorInsertsgRNA targeting human SCGB3A2 locus
ExpressionMammalianPromoterHuman U6Available SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEBG-bZIPa
Plasmid#12436DepositorInsertbZIP of C/EBPa (CEBPA Human)
TagsGSTExpressionMammalianMutationpEBG vector is from Bruce Mayer, may be different…Available SinceJan. 4, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCCLc-U6-shHMGA2.3-PGK-dTomato
Plasmid#89606PurposeSilencing Hmga2 in human cellsDepositorAvailable SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
WT-β3
Plasmid#166579PurposeFor expression of cytoplasmic tail of mouse beta3 integrin with N-terminal GST fusion protein in bacterial cells.DepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCCLc-U6-shHMGA2.2-PGK-dTomato
Plasmid#89605PurposeSilencing Hmga2 in human cellsDepositorAvailable SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
OR2M4_Deletion_gRNA
Plasmid#195194Purposedual gRNAs for deletion of OR2M4 in a third generation Cas9 backbone with GFPDepositorInsertOR2M4 dual gRNA (OR2M4 Human)
ExpressionMammalianAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only