We narrowed to 4,784 results for: AAT
-
Plasmid#12436DepositorInsertbZIP of C/EBPa (CEBPA Human)
UseTagsGSTExpressionMammalianMutationpEBG vector is from Bruce Mayer, may be different…PromoterAvailable sinceJan. 4, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCCLc-U6-shHMGA2.3-PGK-dTomato
Plasmid#89606PurposeSilencing Hmga2 in human cellsDepositorInsertshRNA targeting HMGA2 (HMGA2 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
WT-β3
Plasmid#166579PurposeFor expression of cytoplasmic tail of mouse beta3 integrin with N-terminal GST fusion protein in bacterial cells.DepositorInsertβ3 (Itgb3 Mouse)
UseTagsGSTExpressionBacterialMutationPromoterAvailable sinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
OR2M4_Deletion_gRNA
Plasmid#195194Purposedual gRNAs for deletion of OR2M4 in a third generation Cas9 backbone with GFPDepositorInsertOR2M4 dual gRNA (OR2M4 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCCLc-U6-shHMGA2.2-PGK-dTomato
Plasmid#89605PurposeSilencing Hmga2 in human cellsDepositorInsertshRNA targeting HMGA2 (HMGA2 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Blast-sgSIK2
Plasmid#138708PurposeExpresses a human SIK2-targeting sgRNA and Cas9DepositorInsertsgSIK2 human (SIK2 Human)
UseLentiviralTagsExpressionMutationPromoterhU6Available sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_GFP_Luciferase
Plasmid#155079PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_1
Plasmid#155059PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting TK1 using SpCas9 and HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and HPRT1 using LbCas12a
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shID2 #1
Plasmid#83086PurposeLentiviral shRNA vector for inducible knockdown of human ID2DepositorInsertshID2 (ID2 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNcor1#2/Cre
Plasmid#173606PurposeExpresses a Ncor1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Ncor1 (Ncor1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralTagsExpressionMutationPromoterAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_3
Plasmid#155083PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
PIK3CB gRNA (BRDN0001147768)
Plasmid#76194Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3CBDepositorInsertPIK3CB (PIK3CB Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMY-Ly6G-Rluc_miR
Plasmid#163339PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a Ly6G surface markerDepositorInsertLy-6G (Ly6g Mouse)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterLTRAvailable sinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
NTRK2 gRNA (BRDN0001148065)
Plasmid#76468Purpose3rd generation lentiviral gRNA plasmid targeting human NTRK2DepositorInsertNTRK2 (NTRK2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PBK gRNA (BRDN0001147308)
Plasmid#75574Purpose3rd generation lentiviral gRNA plasmid targeting human PBKDepositorInsertPBK (PBK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMCSF-R(dAB)-luc
Plasmid#12423DepositorInsertM-CSF receptor promoter fragment (CSF1 Human)
UseLuciferaseTagsExpressionMutationNo AML1 and C/EBP binding sites (delete bp -86 to…PromoterAvailable sinceDec. 15, 2006AvailabilityAcademic Institutions and Nonprofits only -
pUDR295
Plasmid#113874Purposeexpression of Cas9 programming sgRNA2 and sgRNA1 targetting GAL2 and HXT4-1-5/ HXT3-6-7 respectivelyDepositorInsertsgRNA2 GAL2 sgRNA1-HXT4-1-5;HXT3-6-7
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only