We narrowed to 11,356 results for: AGA
-
Plasmid#85445PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of a beta-globin reporter.DepositorInserttDNA1 EF1alfa-5xEGFP-TEVprotease-PEST-beta-globin(dI1)-BGH polyA tDNA2 FRT-PEST-TEVsite-PuromycinR
UseMinimal backbone fragment for low-copy bacterial …ExpressionMammalianAvailable SinceFeb. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRB-32-riot_punisher
Plasmid#138988PurposeIVT template for the beta subunit of the mouse TCR #32 that is reactive against MC38DepositorAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRA-32-riot_punisher
Plasmid#138987PurposeIVT template for the alpha subunit of the mouse TCR #32 that is reactive against MC38DepositorAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRB-31-murderous_crow
Plasmid#138986PurposeIVT template for the beta subunit of the mouse TCR #31 that is reactive against MC38DepositorAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRA-31-murderous_crow
Plasmid#138985PurposeIVT template for the alpha subunit of the mouse TCR #31 that is reactive against MC38DepositorAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRB-30-picky_sticky
Plasmid#138984PurposeIVT template for the beta subunit of the mouse TCR #30 that is reactive against MC38DepositorAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgMyc_2
Plasmid#138346PurposeExpress guide RNA 1 for mouse MycDepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Tet-Puro-shIAPEz_2
Plasmid#185017PurposeshRNA mediated knockdownDepositorInsertERV_IAPEz
UseLentiviralAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR-attB-PUb-GFP
Plasmid#183911PurposeattB-site containing docking plasmid for genomic insertion into attP site, encoding GFP under control of the Aedes aegypti PUb promoterDepositorInsertGFP
PromoterAedes aegypti PUbAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
E42_gRunx1_gRNA3_dTet_NGFR
Plasmid#189803PurposeRetroviral delivery of guide RNA against mouse Runx1DepositorInsertgRunx1_gRNA3 (Runx1 Mouse)
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
Fireworks RFP[PTC-] (AVA2515)
Plasmid#85443PurposeExpresses TEV protease and tandemly-repeated RFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of a beta-globin reporter.DepositorInserttDNA1 EF1alfa-5xtdTomato-TEVprotease-PEST-beta-globin(dI1)-BGH polyA tDNA2 FRT-HygromycinR
UseMinimal backbone fragment for low-copy bacterial …ExpressionMammalianAvailable SinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSMP-EZH2_3
Plasmid#36389DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCA24N-ligase-NLS-cTF
Plasmid#87746PurposeIPTG-inducible expression of ligase-NLS-cTF fusion for protein purificationDepositorInsertT4 DNA ligase (30 )
Tags6xHis and NLS linker - cTF (chimeric transcriptio…ExpressionBacterialPromoterT5-lacAvailable SinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330 Human 3' HP1a gRNA
Plasmid#127907PurposeWT Cas9 Vector targeting the 3' end of the human HP1a geneDepositorInsertgRNA for Human 3' HP1a
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-TP5
Plasmid#160088PurposeBacterial expression of Tn5-APEX2 fusion protein with linker GSGAGADepositorInsertTn5 transposase/APEX2 peroxidase fusion protein
TagsFLAG and Mxe intein - Chitin-binding domainExpressionBacterialAvailable SinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
cASPG1-mRFP
Plasmid#181962PurposeASPG1 protein tagged with mRFP, under control of TBA2 promoterDepositorAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW267-lenti-spsgRNA-hsCDH1-sg1-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#170816PurposeLentiviral vector to co-express a human CDH1 spsgRNA (sg1-Cdh1) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR
UseLentiviralExpressionMammalianMutationNAAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
CBX3 A6.5 gRNA
Plasmid#90569Purpose3rd generation lentiviral gRNA plasmid targeting human CBX3DepositorInsertCBX3 (Guide Designation A6.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
1518_pAAV-U6-SA-eGFP-gRNA-HLP-SACas9-HA-OLLAS-spA
Plasmid#109316PurposePlasmid for liver-specific expression of AAV SaCas9 with a gRNA against eGFPDepositorInserteGFP gRNA
UseAAV and CRISPRExpressionMammalianAvailable SinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only