We narrowed to 12,747 results for: CAR
-
Plasmid#153536PurposeAAV-mediated expression of Jaws-KGC-tdTomato-ER2 under the Syn promoter, in floxed/reversed (Cre-dependent) manner.DepositorInsertJaws-KGC-tdTomato-ER2
UseAAVTagsER2, KGC, and tdTomatoExpressionMammalianMutationK200R W214FPromoterSynAvailable sinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT2-shP53
Plasmid#124261PurposeExpresses shRNA targeting P53. Construct has inverted repeats to be used in Sleeping beauty system.DepositorInsertshP53
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 8, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLVX-Flag-CDK19-WT-IRES-ZsGreen
Plasmid#68858PurposeExpresses Human CDK19 Wild-TypeDepositorInsertCyclin-Dependent Kinase 19 (CDK19 Human)
UseLentiviralTagsFlagExpressionMammalianMutationPromoterEF1αAvailable sinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1-FSF-FLEX-ChR2(H134R)-EYFP-WPRE-bGHpA
Plasmid#65454PurposeCan be used to generate AAV virus that will express the ChR2(H134R)-EYFP channelrhodopsin fusion protein in neurons under intersectional control by Flp and Cre recombinasesDepositorInsertChR2(H134R)-EYFP
UseAAVTagsEYFPExpressionMutationH134R variantPromoterhSyn1Available sinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 Sox2 HM a
Plasmid#26353DepositorInsertSox2 shRNA
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailable sinceSept. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
loxP-Puro-loxP-3xV5-SNAP-Rab11 HR
Plasmid#229677PurposeHomology repair plasmid for endogenous tagging of Rab11 at the N-terminus with SNAP tag and a 3x V5 epitope tag. Contains a puromycin resistance cassette for selection of edited cells.DepositorInsertgenomic sequence Rab11 locus (RAB11A Human)
UseCRISPRTagsSNAP, 3xV5ExpressionMutationPromoterAvailable sinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
WT1-2A-eGFP PGK PuroR Donor Plasmid
Plasmid#82333PurposeWT1 targeting donorDepositorUseCRISPR and TALENTags2A-eGFPExpressionMammalianMutationPromoterAvailable sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP
Plasmid#112677PurposeAn AAV vector that expresses a Cre-dependent nuclear-localized Red to Green Fluorescent proteinDepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertNuclear-localized floxed-mCherry EGFP
UseAAVTagsNuclear localization signalExpressionMutationPromoterEF1aAvailable sinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLX304_zeo_mmFbxw7a
Plasmid#160102PurposeExpresses murine Fbxw7 alpha in mammalian cellsDepositorInsertFbxw7alpha (Fbxw7 Mouse)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRIPZ-CTID195-GSQ-UBnc-PURO
Plasmid#208037PurposeEnables inducible expression of C-terminal Split-TurboID-fused UBnc, to perform Ubiquitin-ID; nc = non-cleavable mutation; selection with puromycinDepositorInsertUbnc (UBC Human)
UseLentiviralTagsMyc, C-terminal Split-TurboIDExpressionMutationL73P Mutation near C-terminus suppresses cleavage…PromotertetO/UBCAvailable sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-iGluSnFR4s-PDGFR-WPRE
Plasmid#234435PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianMutationPromoterSynapsinAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ai62(TITL-tdT) Flp-in replacement vector
Plasmid#61576PurposeRecombinase-mediated cassette exchange in ES cells to insert a Cre & tTA-dependent tdTomato expression cassette into a docking site within the mouse TIGRE genomic locusDepositorInsertchromatin insulator flanked TRE-LSL-tdTomato
UseRecombinase-mediated cassette exchange using flp …TagsExpressionMutationPromoterAvailable sinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pInducer10b-HA-KRAS WT CO SR
Plasmid#164926PurposeExpresses HA tagged, codon Optimized and siRNA-resistant, tetracycline-inducible KRAS wild type sequenceDepositorInsertKRAS proto-oncogene, GTPase (KRAS) (KRAS Human)
UseLentiviralTagsHA tagExpressionMutation9 Valine codons are optimized and siRNA targetin…PromoterUbc promoterAvailable sinceMay 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
AP1muA-SNAP-V5-polyA-Puro HR
Plasmid#229680PurposeHomology repair plasmid for endogenous tagging of AP1muA at the C-terminus with SNAP tag and a V5 epitope tag. Contains a puromycin resistance cassette for selection of edited cells.DepositorInsertgenomic sequence AP1M1 locus (AP1M1 Human)
UseCRISPRTagsSNAP, V5ExpressionMutationPromoterAvailable sinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1a-hDNAJC6-T2A-copGFP
Plasmid#170443PurposeLentiviral vector expressing human DNAJC6 with copGFP reporter gene, under control of EF1alpha promoterDepositorInserthuman DNAJC6 (DNAJC6 Human)
UseLentiviralTagsExpressionMutationPromoterEF1aAvailable sinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC763 - pX458 with rat Rosa26 gRNA A
Plasmid#113161PurposeA plasmid that expresses a guide RNA targeting rat Rosa26 as well as FLAG-tagged SpCas9 and GFPDepositorInsertgRNA for rat Rosa26
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBFC0996
Plasmid#186695PurposeVcDART under control of Lac promoter, Vc_2xBsaI_NT gRNA, 2xLguI cargo stuffer, with ET-Seq (AsiSI+SbfI) restriction sites flanking Tn7 Right EndDepositorInsertstnsA
tnsB
tnsC
tnsD
tniQ
cas8-cas5 fusion
cas7
cas6
crRNA
Tn7 transposon
2xLguI Cargo Stuffer
SbfI+AsiSI dual restriction site for donor plasmid removal during ET-Seq
UseTagsExpressionBacterialMutationPromoterPLacAvailable sinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-AlkB
Plasmid#228218PurposeExpress wild type AlkB protein in E. coli BL21(DE3)DepositorInsertAlpha-ketoglutarate-dependent Dioxygenase (alkB Synthetic)
UseTagsHis tagExpressionBacterialMutationcodon optimizedPromoterT7Available sinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
6xHis-MBP-BrCas12b-FNLDTA
Plasmid#195340PurposeExpresses Engineered BrCas12b in BacteriaDepositorInsertBrCas12b
UseCRISPR and Synthetic BiologyTags6xHis Tag and MBP, TEV cleavage site, 6x His TagExpressionBacterialMutationF208W, N524V, L795I, D868V, T874S, A1015EPromoterT7 PromoterAvailable sinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only