We narrowed to 14,449 results for: RING;
-
Plasmid#161949PurposeContains Type IIS restriction site free elements for expression vectors in IBM. Expression vector to generate ORF insertion library in IBM on ECF20DepositorInsertpSB3T5(BsaI-)-PBAD(SapI-)-B33-ECF20(1-5)-BsaI-BsaI-ECF20(187-193)-Ter
ExpressionBacterialPromoterPBADAvailable SinceMarch 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
LB360 (Bcl-2 from -1287 to -1337)
Plasmid#15242DepositorInsertB-cell lymphoma/leukemia-2 (BCL2 Human)
UseLuciferaseTagsLuciferaseExpressionBacterialMutationBcl-2 fragment from -1287 to -1337 with P1Available SinceAug. 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Exon-53_Dual_sgRNA
Plasmid#178107PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick exon-53 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick exon-53 sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.13.EFS-NS.H2B-RFP
Plasmid#170388PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 13. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_MTOR_E2419K_Dual_pegRNA
Plasmid#178110PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 T804N-G6 and MTOR-E2419K pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G6 T804N pegRNA + MTOR-E2419K pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCK-D390TN(UniProt)-FLAG
Plasmid#164693PurposeExpress N-terminally truncated DroshaTN-FLAG in mammalian cellsDepositorInsertN-terminally truncated transdominant negative Drosha (DROSHA Human)
TagsFLAGExpressionMammalianPromoterCMVAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
p35S::IRE1a
Plasmid#135232Purposeconstitutive expression of IRE1a from A. thaliana (AT2G17520; upregulates UPR signaling)DepositorAvailable SinceJan. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28-At_PRORP1-His
Plasmid#67869Purposebacterial expression of PRORP1 (At2g32230), full coding sequence (mitoch./chloropl. form) + C-term. His tagDepositorInsertPRORP1 (PRORP1 Mustard Weed)
TagsHisExpressionBacterialMutationResidues 36-572 (see comments)PromoterT7Available SinceAug. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti.hUbC.H2B-CeruleanFP-2A-Dendra2FP.W
Plasmid#126522PurposeLentivector that expresses H2B-Cerulean and Dendra2 fluorescent proteins from an internal hUbC promoter.DepositorInsertH2B-CeruleanFP-2A-Dendra2FP
UseLentiviralPromoterhUbCAvailable SinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSR06
Plasmid#69152Purposeread-outloxN mCherry to GFP switch for integration on ttTi5605, Mos Chr IIDepositorInsertsmCherry
eGFP
UseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0 and codon-optimzed index…Promoterrps-27Available SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Q842gp120-8his
Plasmid#100932PurposeMammalian expression plasmid for gp120 subunit from the Q842.d12 HIV-1 strainDepositorInsertHIV-1 (Q842.d12) Env
TagsCD5 leader sequence and Purification tag after K5…ExpressionMammalianMutationCodon-optimized synthetic genePromoterCMVAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJY-RpABE-FT_INF
Plasmid#112874Purposebinary vector for INF (Induced Neo-Functionalization) of FT in ArabidopsisDepositorInsertsRPS5A promoter
ABE7.10
U6-sgRNA targeting FT
UseCRISPRExpressionPlantAvailable SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pY036_ATP1A1_G5
Plasmid#86618PurposeExpresses the ATP1A1 G5 crRNA in combination with AsCpf1-3xHA to target ATP1A1 intron 4. U6-crRNA(ATP1A1 G5)-CBh-AsCpf1DepositorInsertATP1A1 G5 crRNA + AsCpf1-3xHA
UseCRISPR; Co-selection via hdr using ouabainTags3xHAExpressionMammalianPromoterCBhAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSHS273 - Bacterial expression plasmid for SpCas9∆REC3 variant
Plasmid#101202PurposeBacterial expression plasmid for SpCas9∆REC3 variantDepositorInsertSpCas9 variant M1–N497,GGS,V713–D1368
Tags10x His, MBP, and TEV siteExpressionBacterialMutationM1–N497, GGS, V713–D1368PromoterT7Available SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEMS2131
Plasmid#111895PurposessAAV genome with MCS for inserting MiniP promoter to drive an emerald GFP (EmGFP) reporter. Contains WPREDepositorTypeEmpty backboneUseAAVAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-SLC35B2-FLAG
Plasmid#154863PurposeTransient or Lentiviral expression of sgRNA (Addgene#154860) resistant SLC35B2DepositorInsertSLC35B2 (SLC35B2 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationctcctggtgcagtacttc => ttattagtccaatattttPromoterCMVAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-FKBP-TPD52
Plasmid#172455PurposeExpression of Tumor Protein D52 (TPD52) with N-terminal GFP-FKBP tagDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2519
Plasmid#91088PurposeModule C, Promoter: OsU3, Gene: Esp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning), Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning)
UseCRISPRPromoterOsU3Available SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
GST-TPD54
Plasmid#172462PurposeBacterial expression of GST-tagged Tumor Protein D52 like 2 (TPD54/TPD52L2)DepositorAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only