We narrowed to 14,449 results for: RING
-
Plasmid#239924PurposesgRNA compatible with TCTP-SynPro-09 and CaMV 35S-SynPro-10 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP991
Plasmid#239913PurposesgRNA-A compatible with TCTP-SynPro-03, TCTP-SynPro-16 and CaMV 35S-SynPro-01 as Level-0 part (Goden Gate)DepositorInsertsgRNA-A
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP992
Plasmid#239914PurposesgRNA-B compatible with TCTP-SynPro-03, TCTP-SynPro-17 and CaMV 35S-SynPro-01 as Level-0 part (Goden Gate cloning)DepositorInsertsgRNA-B
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP993
Plasmid#239915PurposesgRNA-C compatible with TCTP-SynPro-01, TCTP-SynPro-17 and CaMV 35S-SynPro-11 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA-C
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP995
Plasmid#239917PurposesgRNA-E compatible with TCTP-SynPro-04, TCTP-SynPro-06 and CaMV 35S-SynPro-03 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA-E
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP996
Plasmid#239918PurposesgRNA compatible with TCTP-SynPro-05 and CaMV 35S-SynPro-15 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP997
Plasmid#239919PurposesgRNA compatible with TCTP-SynPro-05 and CaMV 35S-SynPro-07 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP999
Plasmid#239921PurposesgRNA compatible with TCTP-SynPro-08 and CaMV 35S-SynPro-04 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP998
Plasmid#239920PurposesgRNA compatible with TCTP-SynPro-06, TCTP-SynPro-13 and CaMV 35S-SynPro-10 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1000
Plasmid#239922PurposesgRNA compatible with TCTP-SynPro-08 and CaMV 35S-SynPro-04 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1007
Plasmid#239929PurposesgRNA compatible with TCTP-SynPro-04, TCTP-SynPro-11 and CaMV 35S-SynPro-08 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSmBit-CHIP-G132N
Plasmid#236065PurposeSmBit-CHIP expression with G132N substitutionDepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRECBRR1-Kva1
Plasmid#240703Purposeinverted BRR1 origin of replication plasmid containing Kva1 recombitron with a donor in the ncRNA to target phzM locus in Pseudomonas aeruginosa PAO1 expressed by Pm promoterDepositorInsertKva1 RT,Kva1 ncRNA, PaRecT and PaSSB
ExpressionBacterialMutationInverted BRR1 origin of replicationAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010C-Eco1
Plasmid#240690PurposeRSF1010 origin of replication plasmid containing Eco1 recombitron with a SapI flanked stuffer in the ncRNA expressed by J23115 constitutive promoterDepositorInsertEco1 RT, Eco1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSmBit-CHIP-K30A
Plasmid#236066PurposeSmBit-CHIP expression with K30A substitutionDepositorAvailable SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only