We narrowed to 1,720 results for: plasmids pcas
-
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pC-sleeping beauty
Plasmid#65487PurposeHSP-driven SB100X Sleeping Beauty transposase in pCasper backbone.DepositorInsertsleeping beauty transposase
ExpressionInsectPromoterHSPAvailable SinceDec. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDG459
Plasmid#100901PurposeSpCas9 with 2A-Puro and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of double knock-outs and large deletions in a single plasmid system.DepositorInsertshumanized CRISPR associated protein 9
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAG and T2A-PuroRExpressionMammalianPromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHSP02
Plasmid#117259PurposeGenome editing for Lactobacillus plantarum WCSF1DepositorInsertCas9, promotor P11-guide-RNA, homologous arms of Lp_0537
UseOtherAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHSB04X
Plasmid#117258PurposeGenome editing for Lactobacillus brevis ATCC367DepositorInsertCas9, promotor PslpA-guide-RNA, homologous arms of Lb_1019
UseOtherAvailable SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX551
Plasmid#60957PurposepAAV-pMecp2-SpCas9-spA (AAV-SpCas9). AAV plasmid expressing Cas9 in neurons under control of truncated mecp2 promoter.DepositorInsertSpCas9
UseAAV and CRISPRTagsHAExpressionMammalianPromoterpMecp2Available SinceNov. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
BPK1520
Plasmid#65777PurposeHuman expression plasmid for SpCas9 sgRNA (need to clone in spacer into BsmBI sites): U6-BsmBIcassette-Sp-sgRNADepositorInsertSpCas9 gRNA backbone, without spacer sequence
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
BPK1520_blastR
Plasmid#175289PurposeHuman expression plasmid for SpCas9 sgRNA with blasticidin co-selectionDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCMV/U6Available SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
C-Terminal Split Cas9 with GyrA intein
Plasmid#58694PurposeExpresses truncated C-terminal SpCas9 domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with N-Terminal Split Cas9 Gyra Intein for full length SpCas9 productionDepositorInsertHumanized C-Terminal S. pyogenes Cas9 with GyrA Csplit Intein
UseAAV and CRISPRTagsGyrA Csplit Intein and NLSExpressionMammalianPromoterCBhAvailable SinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFPcR5
Plasmid#149484PurposeBroad-Host range expression vector, RSF1010 origin, PcaU(AM) repressor, P3B5 promoter, mRFP, Gentamicin Resistance Marker.DepositorInsertPcaU(AM)-mRFP
UseSynthetic BiologyExpressionBacterialPromoterP3B5BAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKPcR5
Plasmid#149467PurposeBroad-Host range expression vector, RK2 and pUC origin, PcaU(AM) repressor, P3B5B promoter, mRFP, Gentamicin Resistance Marker.DepositorInsertPcaU(AM)-mRFP
UseSynthetic BiologyExpressionBacterialPromoterP3B5BAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
N-Terminal Split Cas9 D10A Nickase with GyrA intein
Plasmid#58695PurposeExpresses N-terminus of D10A SpCas9 nickase domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with C-Terminal Split Cas9 Gyra Intein for full length SpCas9 nickase productionDepositorInsertD10A Nickase humanized S. pyogenes Cas9 with Gyra Nsplit Intein
UseAAV and CRISPRTagsGyrA Nsplit Intein, HA Tag, and NLSExpressionMammalianMutationD10A nickase converting mutation to SpCas9PromoterCBhAvailable SinceSept. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTox-EGFPsite1_NGG-PAM (BPK740)
Plasmid#181746Purposep11-lacY-wtx1 derivative toxic plasmid encoding an SpCas9 target site for EGFP site 1 with an NGG PAMDepositorInsertccdB toxin gene and SpCas9 target site (EGFP site 1 NGG PAM)
UseSelection plasmidAvailable SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTox-EGFPsite1_NGA-PAM (BPK754)
Plasmid#181747Purposep11-lacY-wtx1 derivative toxic plasmid encoding an SpCas9 target site for EGFP site 1 with an NGA PAMDepositorInsertccdB toxin gene and SpCas9 target site (EGFP site 1 NGA PAM)
UseSelection plasmidAvailable SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only