We narrowed to 21,484 results for: SPR
-
Plasmid#155050PurposeTOPO vector for the cloning of _the SpCas9 tracrRNA - AsCas12a Direct Repeat (DR) fragment into the pLCHKO hgRNA vectorDepositorInsertSpCas9 tracrRNA and AsCas12a Direct Repeat (DR)
UseCRISPRAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
Topo_SpCas9.tracr_LbCas12a.DR
Plasmid#155049PurposeTOPO vector for the cloning of _the SpCas9 tracrRNA - LbCas12a Direct Repeat (DR) fragment into the pLCHKO hgRNA vectorDepositorInsertSpCas9 tracrRNA and LbCas12a Direct Repeat (DR)
UseCRISPRAvailable SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJW1820
Plasmid#154321PurposeMulti-cassette for SapTrapDepositorInsertGFP^SEC (LoxP)^AID*::3xFLAG
UseCRISPR and Cre/LoxExpressionWormAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMG
Plasmid#138264PurposeYeast intergration vector for integration of dual reporter system at the URA3 locus. Dual reporter system contains constitutive mCherry and constitutive eGFP flanked by iCas9 sites.DepositorInsertseGFP flanked by iCas9 sites
mCherry
UseCRISPRExpressionYeastPromoterTef1Available SinceMarch 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFH85
Plasmid#128198Purposeclassic sgRNA backbone for SpCas9, combine with TaU3 promoter module (pFH33)DepositorInsertclassic sgRNA backbone for SpCas9, combine with TaU3 promoter module (pFH33)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH86
Plasmid#128199Purposeimproved sgRNA backbone for SpCas9, combine with TaU3 promoter module (pFH33)DepositorInsertimproved sgRNA backbone for SpCas9, combine with TaU3 promoter module (pFH33)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgWRN1
Plasmid#125771Purposeconstitutive expression of a guide RNA targeting human WRNDepositorInsertsgWRN1 (WRN Human)
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgWRN2
Plasmid#125772Purposeconstitutive expression of a guide RNA targeting human WRNDepositorInsertsgWRN2 (WRN Human)
UseCRISPRAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330.Pten.b
Plasmid#66588PurposesgRNA for Pten deletionDepositorInsertPten deletion (Pten Mouse)
ExpressionMammalianAvailable SinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lenti-A3An-LRG2.1T
Plasmid#253343PurposeExpresses the N-terminal fragment of a rapamycin-inducible split A3A cytosine base editor together with an sgRNA expression cassette for in vivo base editingDepositorInsertA3An
UseCRISPR and LentiviralTagsmyc-A3An-FRBPromoterEFSAvailable SinceApril 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pH-EF1α-DualPE
Plasmid#236417PurposeFor plant prime editing including large DNA fragment editing in Solanum lycopersicum or other dicotyledonsDepositorInsertEF1α promoter
UseCRISPRExpressionPlantAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-epegRNA-SV40-mCherry
Plasmid#240538PurposeLentiviral backbone plasmid to insert epegRNAs (tevopreq1) of interest with mCherry. The cloning site is BsmBI.DepositorInsertepegRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21a-TEX264_wt-His6
Plasmid#220214PurposeBacterial expression of wild type TEX264, C-terminal His6 tagDepositorAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA-GFP
Plasmid#200068PurposeFor the knock down of GFP with an astrocyte specific mCherry expressionDepositorInsertU6-sgRNA-GFP
UseAAV, CRISPR, and Mouse TargetingTagsGfaABC1D-mCherryPromoterU6, GfaABC1DAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-747_CD19-28z_CAR_TFAP4
Plasmid#207489PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertTFAP4, CD19-28z_CAR (TFAP4 Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_K700E_hSF3B1
Plasmid#176591PurposeAdenoviral construct to change K to E at 700th amino acid (K700E) in human SF3B1DepositorInsertSF3B1 (SF3B1 Human)
UseAAVAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-LbCas12a-Plus-mCherry
Plasmid#191230PurposeTo express the LbCas12a nuclease variant "LbCas12a-Plus" that enhanced the editing activity and specificityDepositorInsertLbCas12a-Plus-P2A-mCherry
UseCRISPRMutationD156R, R883K, R887AAvailable SinceAug. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_023d-sgCiCh2-2
Plasmid#202444PurposeExpression of a CRISPRi control sgRNA that cuts an intergenic region on chromosome 2DepositorInsertChromosome 2 gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnxABE-flgn
Plasmid#187932PurposeA-to-G base editorDepositorInsertecTadA(8e)-nxCas9 (D10A)
UseCRISPRExpressionBacterialAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only