We narrowed to 13,645 results for: sequence
-
Plasmid#172497PurposeSCAT3.2 is fluorescent reporter (FRET probe) for cell survival/apoptosis with Caspase-3 sensitive sequence which can be introduced to mammalian cells by retrovirus vector.DepositorInsertAmcyan
UseRetroviralTagsmVenusExpressionMammalianPromoterMLV LTRAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-ABCB1_STOP
Plasmid#221424PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertABCB1 (ABCB1 Human)
ExpressionMammalianAvailable SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
Luc-T20
Plasmid#177941PurposeTransient mammalian expression of Luc2 (firefly luciferase) along with SARS-CoV-2 sequence 20080-22222 (T20) within the 3'UTR. Resulting transcript is packaged into SARS-CoV-2 virus-like particles.DepositorInsertLuc2 (ORF1ab )
ExpressionMammalianAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-AckRS
Plasmid#137976Purposesequence optimized N‐acetyl lysyl‐tRNA synthetase with cognate tRNA for genetic code expansionDepositorInsertAckRS and pylTcua
ExpressionBacterialPromoteraraBADAvailable SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
PD2529 human beta1 full
Plasmid#221401PurposeMammalian expression of human integrin beta1 full-lengthDepositorInsertintegrin beta1 full-length (ITGB1 Human)
TagsCD33 secretion peptide (MPLLLLLPLLWAGALA) and HA …ExpressionMammalianMutationcodon-optimized mature sequenceAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHSN6A01
Plasmid#50586PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…Promoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
Control-Control-LRG-GFP
Plasmid#225873PurposeTwo copies of guide RNA targeting a control sequenceDepositorInsertControl
UseCRISPR and LentiviralAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
p221a-GUS
Plasmid#71263PurposeEntry clone containing the GUS enzyme. Can be used to construct transcriptional reporters. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertBeta-glucuronidase
UseGatewayAvailable SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAG671 mito-pFAST
Plasmid#172867PurposeExpresses mitochondrial targeting domain-pFAST in mammalian cellsDepositorInsertmito-pFAST
TagsMyc tag (C terminal on insert)ExpressionMammalianPromoterCMVAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-Chrna3-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128338PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTrc99S-ssDsbA-TTc-4xDQNAT
Plasmid#128401PurposePeriplasmic expression of tetanus toxin fragment C with C terminal 4xDQNAT glycosylation sites in E. coliDepositorInsertTetanus toxin fragment C domain
Tags4xDQNAT glycosylation tag, 6xHis tag, and DsbA si…ExpressionBacterialPromotertrcAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmAmetrine-DEVD-tdTomato
Plasmid#18879PurposeCaspase-3 FRET biosensor, mammalian expression of mAmetrine-DEVD-tdTomatoDepositorInsertmAmetrine-DEVD-tdTomato (CASP3 Human, lab constructed)
ExpressionMammalianMutationmAmetrine-tdTomato linker sequence: ...ITLGGTGSGS…Available SinceAug. 13, 2008AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hSyn-nucGFP
Plasmid#140190PurposeOverexpression of GFP with a nuclear localization sequence, under the human synapsin promoterDepositorInsertGFP-NLS
UseLentiviralTagsGFPExpressionMammalianAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIDS-LSD1fl
Plasmid#109157PurposeEncodes human full-length LSD1 to be expressed in a baculovirus/insect cell expression systemDepositorInserthuman full-length LSD1, sequence-optimized for insect cells (KDM1A Human)
ExpressionInsectPromoterp10Available SinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EMTB-TurboID-V5-puro
Plasmid#190741PurposeA lentiviral plasmid encoding EMTB fusion to V5-tagged TurboID on microtubules (EMTB as the microtubule-targeting tag)DepositorInsertEMTB-TurboID-V5 (RPS14 EMTB is human ensconsin; TurboID is engineered BirA from E.coli, Human)
UseLentiviralTagsMycExpressionMammalianMutationMicrotubule binding-domain of ensconsin (amino ac…PromoterCMVAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-RiboL1-jGCaMP8m
Plasmid#169248PurposeAAV transfer plasmid for neuronal expression of soma-targeted (RL-10, ribosomal tag) jGCaMP8m, with a flexible GS-linker sequence attaching the ribosomal tag to the jGCaMP8m protein.DepositorInsertRiboL1-jGCaMP8m
UseAAVTags6xHisExpressionMammalianPromoterhSynAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHSN6I01
Plasmid#50587PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-KRAB, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsdCas9-KRAB
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 that is defective in DNA cleavage; the maiz…Promoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHLSec2-irisin-his
Plasmid#122729PurposeExpresses in mammalian cells (HEK293):glycosylated and secreted irisin-hisDepositorInsertirisin (ectodomain of FNDC5) (Fndc5 Bovine, Mouse, Human, Rat)
Tagshis and signal sequence for secretionExpressionMammalianAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CMV-YFP-CAAX-IRES*-GINIP-Nluc W139A
Plasmid#223560PurposeAlias: Gαi bONE-GO W139A. Lentiviral vector expressing GINIP-Nluc W139A after a low efficiency IRES downstream of YFP-CAAX placed after the promotorDepositorInsertYFP(Venus) - KRas4b - IRES* - human GINIP W139A - linker(GGGS) - Nluc
UseLentiviralExpressionMammalianMutationW139A mutation in GINIP sequencePromoterCMVAvailable SinceMarch 28, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only