We narrowed to 106 results for: 62988
-
Plasmid#62988PurposeCas9 from S. pyogenes with 2A-Puro, and cloning backbone for sgRNA (V2.0)DepositorHas ServiceCloning Grade DNAInserthSpCas9-2A-Puro V2.0
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterCbhAvailable SinceMarch 11, 2015AvailabilityAcademic Institutions and Nonprofits only
These results may also be relevant.
-
pX461-ABE8e-nSpCas9-Intergenic sgRNA
Plasmid#237463PurposeAll-in-one base editor expressing adenine base editor (ABE8e-nSpCas9) and gRNA control targeting Intergenic siteDepositorInsertIntergenic sgRNA
UseCRISPRExpressionMammalianPromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX461-evoCDA1-nSpCas9-Intergenic sgRNA
Plasmid#237464PurposeAll-in-one base editor expressing cytosine base editor (evoCDA1-nSpCas9) and sgRNA control targeting Intergenic siteDepositorInsertIntergenic sgRNA
UseCRISPRExpressionMammalianPromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX462-ABE8e-nSaCas9-Intergenic sgRNA
Plasmid#237465PurposeAll-in-one base editor expressing adenine base editor (ABE8e-nSaCas9) and sgRNA control targeting Intergenic siteDepositorInsertIntergenic sgRNA
UseCRISPRExpressionMammalianPromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX461-ABE8e-nSpCas9-NRF1-ss-sgRNA
Plasmid#237466PurposeAll-in-one adenine base editor (ABE8e-nSpCas9) with gRNA targeting NRF1-Ex7 splice siteDepositorInsertgRNA targeting NRF1-Ex7 splice site
UseCRISPRExpressionMammalianPromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX461-evoCDA1-nSpCas9-NRF1-ss-sgRNA
Plasmid#237467PurposeAll-in-one cytosine base editor (evoCDA1-nSpCas9) with sgRNA targeting NRF1-Ex7 splice siteDepositorInsertsgRNA targeting NRF1-Ex7 splice site
UseCRISPRExpressionMammalianPromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX462-ABE8e-nSaCas9-NRF1-ss-sgRNA
Plasmid#237468PurposeAll-in-one adenine base editor (ABE8e-nSaCas9) with gRNA targeting NRF1-Ex7 splice siteDepositorInsertgRNA targeting NRF1-Ex7 splice site
UseCRISPRExpressionMammalianPromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-1
Plasmid#177781PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-2
Plasmid#177782PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-RAB7A-gRNA2 (PX459)
Plasmid#221552PurposeExpresses Cas9 and gRNA for disruption of Rab7A gene in human cellsDepositorAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
INS-3'gRNA
Plasmid#210468PurposegRNA targeting INS 3' terminal for CRISPR-Cas9-mediated knock-inDepositorInsertINS (INS Human)
UseCRISPRAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon5
Plasmid#177763PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon8
Plasmid#177764PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEN243-EN1953
Plasmid#224546PurposeCas9-2A-puro and sgRNA targeting the first coding ATG of mouse NipblDepositorInsertCas9-2A-puro and sgRNA targeting the first coding ATG of mouse Nipbl (Nipbl Mouse)
ExpressionMammalianAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459v3
Plasmid#178799PurposeSpCas9 with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX461-ABE8e-nSpCas9
Plasmid#237460PurposeTransfection-based all-in-one base editor plasmid that expresses both adenine base editor (ABE8e-nSpCas9) and single guide RNAs (sgRNA) with BpiI cloning sites to clone sgRNA.DepositorInsert3xFlag_ABE8e_SpCas9(D10A)_6xNLS
UseCRISPRTags3xFLAGExpressionMammalianMutationD10APromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX461-evoCDA1-nSpCas9
Plasmid#237461PurposeTransfection-based all-in-one base editor plasmid that expresses both cytosine base editor (evoCDA1-nSpCas9) and single guide RNAs (sgRNA) with BpiI cloning sites to clone sgRNA.DepositorInsert3xFlag_evoCDA1_ssDBD_nickase SpCas9 _6xUGI
UseCRISPRTags3xFLAGExpressionMammalianMutationD10APromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX462-ABE8e-nSaCas9
Plasmid#237462PurposeTransfection-based all-in-one base editor plasmid that expresses both adenine base editor (ABE8e-nSaCas9) and single guide RNAs (sgRNA) with BpiI cloning sites to clone sgRNA.DepositorInsert3xFlag_ABE8e_SaCas9 -6xNLS
UseCRISPRTags3xFLAGExpressionMammalianMutationD10APromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEN243-KH217
Plasmid#224550PurposeCas9-2A-puro and sgRNA targeting the STOP codon mouse Car2DepositorInsertCas9 and sgRNA targeting the STOP codon of mouse CAR2 (Car2 Mouse)
UseCRISPRExpressionMammalianAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only