We narrowed to 4,390 results for: GCA;
-
Plasmid#85544PurposeConstitutive transcription of crRNA of crtYf, Spectinomycin resistanceDepositorInsertcrRNA of crtYf
UseCRISPR; Shuttle vector corynebacterium glutamicum…ExpressionBacterialAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-dCas9
Plasmid#125687PurposeGene knockdown for actinomycetesDepositorInsertstreptomyces codon optimized spdCas9, sgRNA casette
UseCRISPR and Synthetic BiologyPromoterermE*/tipAAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJYS2cm_crtYf
Plasmid#85543PurposeConstitutive transcription of crRNA of crtYf, Chloramphenicol resistanceDepositorInsertcrRNA of crtYf
UseCRISPR; Shuttle vector corynebacterium glutamicum…ExpressionBacterialAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
ATG16L1 sgRNA
Plasmid#207563PurposepX330 expressing Cas9 and a sgRNA targeting the ATG16L1 locusDepositorInsertGCAGCAAGTGACATGTCGTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLH-stsgRNA3.1
Plasmid#64118PurposeVector for expression of St1 sgRNA3.1 in mammalian cellsDepositorInsertSt1 sgRNA3.1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSWAP_Entry_T2
Plasmid#184864PurposepSwap plasmid part containing the T2 sgRNA module for the Swap and Drop recombination system.DepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSWAP_Entry_T1
Plasmid#184863PurposepSwap plasmid part containing the T1 sgRNA module for the Swap and Drop recombination system.DepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pG4
Plasmid#162605PurposeEdit Ade2 gene in yeastDepositorInsertTef1-Cas9 with RPL25 Intron
ExpressionYeastAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
Level 1 P4 TaU6 guide acceptor
Plasmid#165600PurposeGoldenGate (MoClo) Level 1 Position 4 TaU6 guide acceptor plasmidInsertTaU6 promoter::LacZ::sgRNA scaffold
UseCRISPR and Synthetic Biology; Sgrna acceptor with…Available SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
Level 1 P3 TaU6 guide acceptor
Plasmid#165599PurposeGoldenGate (MoClo) Level 1 Position 3 TaU6 guide acceptor plasmidInsertTaU6 promoter::LacZ::sgRNA scaffold
UseCRISPR and Synthetic Biology; Sgrna acceptor with…Available SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-SMG6-CDS-1
Plasmid#136046PurposeSMG6 shRNA (Targeting CDS #1) inserted into the PLKO.1 plasmid (AACTTGTAAGTAACCTGCAGC)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSK-Sasg
Plasmid#214350PurposeExpresses cloning backbone for SlugCas9 sgRNADepositorInsertSlugCas9 tracrRNA
ExpressionMammalianAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDropVn
Plasmid#184873PurposeChromosomal transfer helper plasmid with sgRNAs (one fixed, one flexible) for Vibrio natriegens genome editing protocol.DepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX-EGFP-g1
Plasmid#107273PurposeeGFP sgRNA-1 and Cas9 expression vector (aka. pX-ps1)DepositorInsertGFP sgRNA-1
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiX2-PURO-shGFP
Plasmid#61230PurposeLentivirus expressing shRNA to GFPDepositorInsertGFP
UseLentiviralPromoterH1/TOAvailable SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBa.VAMP2-GFP-SBP
Plasmid#180249PurposeMammalian expression of VAMP2DepositorAvailable SinceMarch 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AksgRNA
Plasmid#121955PurposeMammalian expression, Genome editing, gRNA scaffoldDepositorInsertAkCas12b single chimeric gRNA
ExpressionMammalianAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AasgRNA
Plasmid#121954PurposeMammalian expression, Genome editing, gRNA scaffoldDepositorInsertAaCas12b single chimeric gRNA
ExpressionMammalianAvailable SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only