We narrowed to 13,645 results for: sequence
-
Plasmid#222945PurposeExpression of TPOR with ALFAtag and monomeric XFP in mammalian cellsDepositorInsertThrombopoietin receptor (26-635) (MPL Human)
TagsALFAtag, Ig k-chain leader sequence, and mXFPExpressionMammalianMutationmXFP: tryptophan 66 to phenylalanine, TPOR: Signa…PromoterCMVAvailable SinceJan. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
Flrt2-Fc-His
Plasmid#72074PurposeExpresses the extracellular region of the FLRT2 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Pblu-AAVS1-Cas9-p300-M2rtTA-AAVS1
Plasmid#112261PurposeDonor plasmid with a Cas9-p300 expression cassette, a M2rtTA expression cassette, a T2A-puro selection cassette, and two gRNA recognition sequences at both ends of the whole insertion DNA fragment.DepositorInsertspCas9-p300 (EP300 Human, Synthetic)
ExpressionMammalianAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
VBS mutant of alpha catenin sensor
Plasmid#71710PurposeThis form of the alpha catenin conformation sensor lacks the vinculin binding site and does not bind vinculin.DepositorInsertalpha-catenin ΔVBS FRET Sensor
TagsECFP and YPETExpressionMammalianMutationDeleted amino acid residues 316-405 in α -catenin…PromoterCMVAvailable SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTrc99S-ssDsbA-EPA-DNNNS-DQNRT
Plasmid#128404PurposePeriplasmic expression of P. aeruginosa exotoxin A with DNNNS and DQNRT internal glycosylation sites in E. coliDepositorInsertExotoxin A (toxA P. aeruginosa)
Tags6xHis tag and DsbA signal sequence for periplasmi…ExpressionBacterialMutation242DNNNS246 and 384DQNRT388 engineered glycosylat…PromotertrcAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
ZIKV_Trigger_27B
Plasmid#75008PurposePortion of Zika Virus genome (KU312312: 1348-1494) containing sensor 27B trigger sequenceDepositorInsertZIKV_Trigger_27B
ExpressionBacterialPromoterT7Available SinceFeb. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(S)-Fc-His
Plasmid#72138PurposeExpresses the Sema3A protein (truncated at cleavage site P1; ie, short), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMTB2-Avi-Cerulean-RanGAP
Plasmid#79878PurposeBeta-actin2 promoter driving N-term Avi-tagged protein containing Cerulean protein fused to the carboxy-terminal domain of avian Ran GTPase-activating protein 1 (RanGap1); flanked by Tol2 sequencesDepositorInsertCerulean protein fused to the carboxy-terminal domain of avian Ran GTPase-activating protein 1 (RanGap1) (RANGAP1 Chicken)
TagsAviExpressionBacterialPromoterBeta-actin2Available SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nrp2.3-AP-His
Plasmid#71974PurposeExpresses the extracellular region of the Neuropilin 2, isoform 3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-BG505.SOSIP-QES.i03.c01-TM
Plasmid#111845PurposeMammalian expression plasmid for BG505 SOSIP.664 fused to a transmembrane tether; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 Env (BG505 SOSIP.664)
TagsCD5 leader sequence and TM helix from MHC class IExpressionMammalianMutationCodon-optimized synthetic gene; has SOSIP mutatio…PromoterCMVAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ntng2.b-AP-His
Plasmid#71995PurposeExpresses the extracellular region of the Netrin G2, isoform b protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC25
Plasmid#62328PurposesgRNA + 1x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
BMR1_01g02031-bio-His
Plasmid#108116Purpose[Edit] Expresses enzymatically monobiotinylated full-length BMR1_01g02031 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tagDepositorInsertBMR1_01g02031
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
nCre-ST-NLS-P2A-NLS-pSC-cCre
Plasmid#207638PurposeA plasmid encoding N-terminal Cre fused to SpyTag (ST) and photocaged SpyCatcher (pSC) fused to C-terminal Cre with a nuclear localization signal (NLS) sequenceDepositorInsertnCre-SpyTag-NLS-P2A-NLS-photocaged SpyCatcher-cCre
ExpressionMammalianMutationAmber stop codon at SpyCatcher’s critical lysinePromoterCMVAvailable SinceOct. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTrc99S-ssDsbA-TTlight-4xDQNAT
Plasmid#128402PurposePeriplasmic expression of tetanus toxin light chain with C terminal 4xDQNAT glycosylation sites in E. coliDepositorInsertTetanus toxin light chain domain
Tags4xDQNAT glycosylation tag, 6xHis tag, and DsbA si…ExpressionBacterialMutationInactivating E234A mutationPromotertrcAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.a-AP-His
Plasmid#71984PurposeExpresses the extracellular region of the Netrin G1, isoform a protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Dscaml1-Fc-His
Plasmid#72072PurposeExpresses the extracellular region of the Dscaml1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
piGECI-NES-N1
Plasmid#160422PurposeExpression of a near-infrared genetically encoded calcium indicator iGECI with a nuclear export signal sequenceDepositorInsertiGECI-NES
ExpressionMammalianPromoterCMVAvailable SinceNov. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-FLIP pr5
Plasmid#19130DepositorInsertFLIP promoter (CFLAR Human)
UseLuciferaseExpressionMammalianMutationThe sequence corresponds to positions -503 to +28…Available SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only